Adventure 234

adventure

where actions speak louder than words

where actions speak louder than words

SCALING

EVEREST

"WITH A

LITTLE HELP

FROM

MY FRIENDS"

ISSUE 234

OCT/NOV 2022

NZ $10.90 incl. GST

time to get busy

The effects of global warming will effect us all at some stage

Even when we really try not to be, we are, by nature, selfish

creatures. At our core belief, the instinct of fight or flight is what

has kept us as species alive; there was never an option to give up

and be eaten. But there really is a third option: just ignore it, and it

might go away.

I consider myself a pretty good citizen; they ask us not to speed, I

don’t speed; they ask us to wear a mask, I wear a mask; they ask

us to get vaccinated, and I get vaccinated. But when it comes to

the more significant worldwide issues I can be a little savoir-faire.

Sure, I say the right words or nothing, but if it does not affect me,

then it tends not to mean too much to me.

For example, global warming or climate change, I know it’s been a

hot topic for a while, but it didn’t really worry or affect me – excuse

the weather analogy, but I considered it a bit of a storm in a teacup.

Now that ‘teacup storm’ has spilt over into my saucer.

Enter selfish Steve...

In June this year, we moved to the Central Plateau to ski,

tramp and fish during the winter season. What was evident

from basically day one was how warm it was. We had a nice

early dump of snow, and everything for Ruapehu seemed to be

on track; covid was behind us, lockdowns a thing of the past

and snow was now on the slopes. But with unusually warm

winds blowing in from Australia, which we get sometimes but

not as consistently as this year, weather patterns that had

historically bought snow to the mountain instead bought rain and

continuously washed off whatever snow managed to stick to the

slopes on the chillier days.

Some years we have had a very early dump of snow in May;

everyone since has had expectations of the ski season starting

with everything open, but as it drags out slow to fully open, as it

often does, the optimists among us always maintain - its winter

and snow will come - in 2022 it really didn’t. With Ruapehu

not getting its usual allocation of good snow in 2022, maybe

not be under the banner of global risk; but when you squeeze

past the conspiracy theorist and start looking at global warming

phenomena, there are a lot of bright people making a lot of loud

noises that we should be taking note of.

For every consequence of global warming in 2022, it seems to be

some of the worst in recorded history!

• Sea level will rise by 1-8 feet by 2100

• Weather will become more intense

• Long wildfire season. - Nearly 660,000 hectares of European

are the worst in recorded history

• More intense droughts - As in China right now, the worst in

recorded history.

• Global temperature will continue to rise; 2022 was the 6th

warmest year in recorded history.

• Unexpected heat waves -This year's European heatwave

was the highest on record, with temperatures over 40

degrees.

• Flooding in Pakistan was the worst in recorded history

• Melting glaciers

That brings us back to our internal instinct for survival ‘fight

or flight’. There is nowhere to fly to; we are all stuck here, so

that leaves us to fight. The first punch to be thrown should be

awareness, and we will at Adventure do our best in coming issues

to look at some of these implications, opinions and how we can

affect the future.

In my google browsing, one quote stood out to me, and that was

by Barak Obama.

“We are the first generation to feel the effect of climate change

and the last generation who can do something about it.”

Barack Obama, Former US President

Its time to get busy

Steve Dickinson - Editor

your Adventure starts with Us

23 Locations Nationwide | www.radcarhire.co.nz | 0800 73 68 23 | [email protected]

page 12

Image by Lauren Murray Image by Eric Skilling

Image by Derek Cheng

page 18

page 24

contents

12//The Joys and Pains of Danger Walking

by Derek Cheng

18//Exploring Arthurs Pass National Park

By Eric Skilling

24//Billion Star Overnight Stays

Eric shares his top camping spots

26//On Thick Ice

Ash Routen explores the frozen surface of Lake Baikai

32//Big Pine Lakes

By Paige Hareb and Lauren Murray

38//Focus on Ruapehu Region

• Paddle the Whanganui Journey

• Taranaki Falls

• The Northern Circuit

70//Expanding Horizons

Matt Butler goes exploring with a rod in hand

76//Adventure Travel

• Samoa

• Rarotonga

• Tahiti

• Vanuatu

plus

50. gear guides

93. active adventure

FOLLOW US ON

www.facebook.com/adventuremagnz

adventuremagazine

www.adventuremagazine.co.nz

Nzadventuremag

JOIN THE CONVERSATION

#ADVENTUREMAGAZINE

Image by WSL

page 82

EDITOR & ADVERTISING MANAGER

Steve Dickinson

Mob: 027 577 5014

[email protected]

ART DIRECTOR

Lynne Dickinson

[email protected]

SUBSCRIPTION ENQUIRIES

subscribe at www.pacificmedia-shop.co.nz

DISTRIBUTION

Ovato, Ph (09) 979 3000

OTHER PUBLICATIONS (HARDCOPY AND

ONLINE)

www.adventuremagazine.co.nz

www.adventuretraveller.co.nz

www.adventurejobs.co.nz

www.skiandsnow.co.nz

@adventurevanlifenz

PUBLISHERS

NZ Adventure Magazine

is published six

times a year by:

Pacific Media Ltd,

11a Swann Beach Road

Stanmore Bay

Whangaparaoa, New Zealand

Ph: 0275775014

Email: [email protected]

advertising rates, demographic

and stats available on request

Contributions of articles and photos are welcome and must be accompanied by a stamped self-addressed envelope. Photographic

material should be on slide, although good quality prints may be considered. All care is taken but no responsibility accepted for

submitted material. All work published may be used on our website. Material in this publication may not be reproduced without

permission. While the publishers have taken all reasonable precautions and made all reasonable effort to ensure the accuracy of

material in this publication, it is a condition of purchase of this magazine that the publisher does not assume any responsibility or

liability for loss or damage which may result from any inaccuracy or omission in this publication, or from the use of information

contained herein and the publishers make no warranties, expressed or implied, with respect to any of the material contained herein.

we ARE tramping

Adelaide Tarn

Kahurangi National Park

Photo: Mark Watson

Whether it’s a day trip with the family or a multi-day adventure deep into the wilderness, Bivouac has the best

gear, from the top brands, to keep you safe, comfortable, warm and dry. Our friendly staff are happy to provide

expert advice, ensuring you get the right equipment and the right fit. If you need it for tramping, we have it,

because at Bivouac Outdoor we ARE tramping.

Supporting Aotearoa's Backcountry Heritage

STORES NATIONWIDE

www.bivouac.co.nz

BEHIND THE COVER...

SCALING

EVEREST

"WITH A

LITTLE HELP

FROM MY

FRIENDS"

Former British soldier and mountaineer,

Hari Budha Magar, is calling on the

climbing community to help him prove that

disability is not a barrier as he attempts

to become the world’s first double abovethe-knee

amputee to climb Everest.

Having served in the British Army’s

Ghurka regiment for 15 years, Hari

turned to mountaineering in 2016 as part

of his recovery having lost both legs in

Afghanistan in 2010 after an Improvised

Explosive Device (IED) exploded while on

patrol.

In preparation for his Everest attempt,

Hari has already been the first double

above knee amputee to climb the Mera

Peak (6,476m); Ben Nevis, trek to Everest

Base Camp, climb Mt Toubkal (4,167m),

and climb Chulu Far East (6,058m).

Hari will take on the world’s tallest

mountain in May 2023 – making history

as the first double above the knee

amputee to do so.

Through his expedition, Hari hopes

to inspire veterans, and others with a

disability, to realise that ANYONE can

achieve their dreams, no matter how big

or impossible they may seem.

To attempt the Everest summit, Hari

needs to raise over £300,000.

To help reach this monumental target,

Hari has launched a Crowdfunder

campaign and is calling on the climbing

community to support his expedition.

“Everest is my ultimate challenge,” said

Hari.

“The human body is just not designed to

operate at that altitude. But add to that my

challenges with mobility and speed, and

there is a whole new layer of difficulty.

“It’ll take me longer than able bodied

climbers, so I’m resigned to the fact that

I’ll be starting earlier and finishing later.

We’ve also planned two extra camps if

they are needed.

“That means more kit, and a greater risk

for all of us on the mountain – so we are

planning out every detail.”

The 43-year-old from Canterbury is being

trained by, and climbing with, Krishna

Thapa, former Chief Mountain Instructor

at the SAS and world-renowned climber,

and Hari now has 9 months to prepare for

the ultimate summit attempt in May 2023.

With reduced mobility, Hari uses three

times more energy than the average

climber, with Everest expecting to take

him three times longer than an ablebodied

mountaineer.

He will climb to the 8,848.86m (29,029ft)

summit of Everest across the South Col

route from Nepal, negotiating some of

the world’s toughest mountaineering

conditions.

Cutting-edge equipment and technology

will be important, but this is a true test of

Hari’s human limits, both physical and

mental.

Hari added: “From specially designed

crampons to the heated sockets around

my stumps and the short prosthetic

legs I’ll be using for the climb – we are

developing new technologies that will

allow me to climb Everest.

“But it’s much more than that, everything

needs to be adapted to get me onto the

mountain right down to made to measure

clothing.”

In 2018, Hari joined forces with other

climbers and disability charities to

successfully overturn a ban on double

amputees and the visually impaired from

climbing Everest at the Supreme Court in

Nepal.

“It’s already been an adventure getting to

this point, but through the climb I hope we

can positively transform the way people

with a disability are perceived, and how

they perceive themselves,” Hari added.

Krishna Thapa, who is not only Hari’s

climbing and expedition leader, but has

also been training with Hari since 2016,

said: “I’ve worked with some tough guys

in my time, but Hari is up there with the

toughest.

“If he puts his mind to a task, you are

damn sure that he’s going to give it every

fibre of his being to get the job done.

“There are no words to describe

the monumental challenge that he’s

undertaking, but we’ll be there every step

of the way – and this time next year I can’t

wait to share that special moment with

Hari on top of the world.”

To support Hari’s Everest expedition, visit:

www.crowdfunder.co.uk/p/harieverest

4//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

Image by Andy Bate

www.andybate.com

PATAGONIA

EARTH IS NOW

OUR ONLY

SHAREHOLDER

All images thanks to Patagonia

Over fifty years ago, Yvon Chouinard started Patagonia, as a

climber more than a businessman, he developed a massive

international clothing and accessory company. In those fifty

years, Patagonia has become one of the most respected and

environmentally responsible companies on earth.

This week Chouinard made the most significant commercial

move in the adventure industry history!

Chouinard, his wife and two adult children have reassigned

their ownership of Patagonia and relinquished it, a value of

about three billion dollars, to a trust called Patagonia Purpose

Trust and a non-profit organisation called Holdfast Collective.

These trusts have been created to ensure that the $100

million-plus of Patagonia’s yearly profits are used to combat

climate change and protect undeveloped land worldwide.

Chouinard has given his company away to the betterment of

the planet.

I have been a fan of Yvon Chouinard since reading his

book "Let My People Go Surfing: The Education of a

Reluctant Businessman", written in 2005. Patagonia,

as a brand, has constantly led the way in environmentpositive

based products and has a loud voice regarding

political issues that affect the environment.

From a piece in the New York Times by David Gelles:

"In some ways, the forfeiture of Patagonia is not

surprising coming from Mr Chouinard. As a pioneering

rock climber in California's Yosemite Valley in the 1960s,

Mr Chouinard lived out of his car and ate damaged cans

of cat food that he bought for five cents apiece. Even

today, he wears raggedy old clothes, drives a beat-up

Subaru, and splits his time between modest homes in

Ventura and Jackson, Wyo. Mr Chouinard does not own

a computer or a cell phone.”

The handing over of the family fortune is not outside of

Chouinard’s long-standing disregard for how the world

does business and his evident love and support for the

world’s environment.

"We are going to give

away the maximum

amount of money

to people who are

actively working on

saving the planet.”

At age 83, Chouinard said, "we are going to give away

the maximum amount of money to people who are

actively working on saving the planet.”

He also said in a recent interview.

‘Hopefully, this will influence a new form of capitalism

that doesn’t end up with a few rich people and a bunch of

poor people.”

The 3-billion-dollar handover was not cheap; the money

was deemed a gift by the US tax department, and that

gift came at the cost of 17.5 million!


THE ORTLES FAMILY

RELY ON YOUR BEST FRIENDS

ORTLES ASCENT MID GORE-TEX® BOOT

BOBO.CO.NZ/SALEWA

The founder of Patagonia, Yvon Chouinard

Before that handover, Patagonia already donated $50 million

to the Holdfast Collective and will provide another $100 million

this year, making Holdfast already one of the biggest influences

in climate change and global warming.

Succession, for any significant business, is often a headache,

especially if you have been at the forefront of environmental

change, which has been a hardcore foundation of Patagonia.

Chouinard’s children, now in their forties, did not want to take

over the company. Chouinard has an out-spoken view of the

stock market and making a business public, so the gifting of the

3-billion-dollar ownership and the 100 million-a-year profit is a

natural solution for the man that is Yvon Chouinard.

“I didn’t know what to do with the company because I didn’t

ever want a company,” he said. “I did not want to be a

businessman. Now I could die tomorrow, and the company will

continue doing the right thing for the next 50 years, and I do not

have to be around.”

The company has given away 1 per cent of its sales for years

to environmental groups. Recently, the company has become

more politically active, even raising a lawsuit against the Trump

administration to successfully protect the Bears Ears National

Monument San Juan County in South-Eastern Utah.

People like what Patagonia stands for and have continued to

purchase the brand even though it costs more; Patagonia’s

sales continue to soar.

But as Chouinard's net worth continues to climb, it is something

that he is openly uncomfortable about as he is vocal re the rich

and excessive wealth. He said in a recent interview. "I was in

Forbes magazine listed as a billionaire, which pissed me off,”

he said. “I do not have $1 billion in the bank. I do not drive a

Lexus.”

Now that the pathway for Patagonia as a company is clear,

with noble objectives of both being a profitable company and

investing those profits solely in tackling climate change and

environmental issues. However, the question remains, will

Patagonia survive without Chouinard’s driving force and the

unusual situation of the profit going directly into the trusts?

"Instead of “going public” you could

say we’re “going purpose”. Instead

of extracting value from nature and

transforming it into wealth for investers,

we’ll use the wealth Patagonia creates to

protect the source of all wealth."

For Chouinard, this gifting of the company to a trust and a

non-profit organisation is a typically ‘Patagonia’ unique way of

approaching complex issues. This situation, whether successful

or not, will ensure the company profits will continue to be put

to beneficial use. It also resolves the question of what will

happen to Patagonia after its founder is gone, ensuring that the

company's profits will be put to work protecting the planet.

Mr Chouinard summed it up by saying. "I feel relief that I've put

my life in order.”

Will this ‘’gifting of success’’ back to the planet be an example

to others? I guess we will have to wait and see, but if history

has shown us anything regarding Patagonia and its success, it

is that as a moral innovator, Patagonia has motivated a whole

industry since its inception – Chouinard’s legacy maybe is more

than just his contribution.

We will leave you with words from the man himself…

“It’s been nearly 50 years since we began our experiment

in responsible business, and we are just getting started. If

we have any hope of a thriving planet – much less a thriving

business – 50 years from now, it’s going to take all of us doing

what we can with the resources we have. This is another way

we’ve found to do our part.

Despite its immensity, the Earth’s

resources are not infinite, and it’s clear

we’ve exceeded its limits. But it’s also

resilient. We can save our planet if we

commit to it.”


DISCOVERED

UNDER ICE.

SERVED

OVER ICE.

#OpenForAdventure

TheShackletonWhisky.com

Please enjoy Shackleton responsibly

BOULDER BASH

‘SEE NO EVIL ROUTES, HEAR NO EVIL BETA, SPEAK NO NEGATIVITY’

By Zane Bray

AUCKLAND’S BOULDERING SCENE IS BLOWING UP!

Auckland’s seeing a massive resurgence in social boulder

competitions this year in the post covid environment, with the

Auckland Boulder series leading the charge, building up to

the National Indoor Boulder Series, and culminating in the

phenomenal next level annual Northern Rocks Boulder Bash.

On 2nd July Northern Rocks opened their doors to the Boulder

Bash community competition. The stoke was high, the boulders

were fresh and the prize pool was over stacked. It was a perfect

storm of super awesomeness.

Sarah Hay, Northern Rocks Director and General Manager

was the main instigator and team leader, managing juggling a

runaway dog, hungry baby and hundreds of people scrambling

over the walls with aplomb. The MC’ing went to Zahnay (Zane

Bray) the word maker with more energy than Red bull, V and

Monster energy put together. Zane brought high energy to the

MC role, couldn’t read his own handwriting, talked so much the

PA system died, and delivered the hype.

Zane represents the Aotearoa Climbing Access Trust (ACAT)

events team. ACAT.org.nz is a not for profit trust set up to

help gain, maintain, and sustain access to our amazing

outdoor climbing areas with some massive wins lately that

would not have happened if it weren’t for the support of our

sponsors recurring donors in the climbing community, signing

up to support ACAT with as little as $5 a month (more would

be better!) goes a long way to ensure they can keep going.

Northern Rocks is proud to be ACAT’s first corporate sponsor

and looks forward to working together with ACAT this year on

events and initiatives to keep NZ crags open.

Before kicking things off, Zane had competitors put a hand on

their heart and recite the boulderers pledge from the Castle hill

climbing guide bible, with words along the lines of ‘I will See

no evil routes, hear no evil beta, speak no negativity’ or was it

‘Lo, though I walk through the valley of boulders, I shall fear no

route…’

Then it was GO time, participants rushed off to get in the

first send of the day, DJ dynamic duo Movr&Shkr and Almita

dropped the phat beats, everyone racing to get scores on their

sheets, people were climbing, boogieing, shouting support,

sharing beta, making friends, shredding skin and falling all over

the mats. There were fist bumps, laughter, worn skin, fails and

many sends.

The boulders the Northern Rocks team delivered were not

all straight forward, there was a lot of skill required to wrestle

and wrangle your way through the world class setting from the

Northern Rocks setting team, with James FM and Wiz Fineron

creating some stellar magic on the finals routes.

Check out @northernrocks.climbing on Instagram to see their

time lapse video of the comp and some of the rad routes on tap.

As always, Eddie Fowke, world class photographer from the

Circuit climbing was there, snapping all the amazing pictures

you see here.

None of this would be possible without the help of our fantastic

sponsors, Rab Equipment, Mountain Adventure, Southern

Approach, Bivouac Outdoor, Musashi, Off Piste, Bootleg Jerky,

Fergs Kayaks Auckland, Adventure Magazine, Cx3 Chalk Bags

and Northern Rocks.

“Northern Rocks is an indoor bouldering

facility, we foster community, growth

and positive experiences for people of all

backgrounds, ages and abilities.”

World Class Indoor Climbing

First visit $25* then free for a week!

Fantastic community, beginners

welcome, boulder classes for all ages

and abilities, inquire now.

* Discounts for youths and own gear

Student Mondays, entry $15

www.northernrocks.co.nz

@northernrocks.climbing

Unit 17, 101-111 Diana Drive,

Wairau Valley, Auckland | 09 278 2363

We are

the mountain

people.

e are

e mountain

ople.

Everything we make is designed by climbers,


for climbers. Each piece is crafted by peak

for climbers. Each piece is crafted by peak

and crag to give you absolute protection,

and crag to give you absolute protection,

comfort and mobility when you really need it.


WWW.RAB.EQUIPMENT

WWW.RAB.EQUIPMENT

Available now from Rab specialist stores throughout NZ.

Hunting And Fishing New Zealand Available stores nationwide. now from Auckland: Rab specialist Living stores Simply, throughout Waikato: NZ. Trek N Travel, Equip Outdoors,

Hunting And Fishing Taupo: New Outdoor Zealand Attitude, stores Wellington: nationwide. Dwights Auckland: Outdoors, Living Motueka: Simply, Waikato: Coppins Trek Outdoors, N Travel, Equip Outdoors,

Nelson: PackGearGo, Taupo: Outdoor Kaikoura: Attitude, Coastal Wellington: Sports, Christchurch: Dwights Outdoors, Complete Motueka: Outdoors, Coppins Greymouth: Outdoors, Colls Sports,

Nelson: PackGearGo, Hokitika: Wild Kaikoura: Outdoorsman, Coastal Wanaka: Sports, Christchurch: MT Outdoors, Complete Queenstown: Outdoors, Small Greymouth: Planet. Colls Sports,

Online: huntingandfishing.co.nz, Hokitika: Wild Outdoorsman, dwights.co.nz, Wanaka: outdooraction.co.nz, MT Outdoors, mtoutdoors.co.nz, Queenstown: Small smallplanetsports.com,

Planet.

Online: huntingandfishing.co.nz, equipoutdoors.co.nz, dwights.co.nz, gearshop.co.nz, outdooraction.co.nz, outfittersstore.nz

mtoutdoors.co.nz, smallplanetsports.com,

Distributed equipoutdoors.co.nz, by Outfitters 0800021732 gearshop.co.nz, www.outfitters.net.nz

outfittersstore.nz

Distributed by Outfitters 0800021732 www.outfitters.net.nz

THE JOYS

& PAINS OF

'DANGER -

WALKING'

Words and photos by Derek Cheng

‘Elbows out’ was the advice I’d been

given for climbing in the European Alps.

This wasn’t related to any particular

style of climbing, but rather what might

help get you to the base of your route

ahead of other climbers. Of the 60

people sardined into the 6.10am cable

car bin heading up the famous Aiguille

du Midi, in the Mont Blanc massif, up to

half of them tend to be climbers.


Chris Davis surveys the

terrain on the classic Cosmic

Arete, on Aiguille du Midi

in the French Alps, as well

as the several climbers

clogging the way.

Above: A climber negotiates Chèré Couloir, a steep ice gully on Mont Blanc du Tacul in the European Alps.

Right: Classic routes, such as Chèré Couloir, are often congested in Chamonix, France, and it's a race to get there first.

The ride is famous, taking you from 1035m

to 3777m above sea level in a scarcelybelievable

20 minutes. But instead of taking

in the dramatic views of the alps as you

ascend from the small township Chamonix,

France, climbers surreptitiously eyeball each

other while sneakily edging towards the

door.

Our objective was Chèré Couloir: a 155m ice

climb that rises from the snowy valley before

steepening to a narrow chute of 75 degree

ice. It’s rightfully described in the guidebook

as 'one of the busiest routes in Chamonix',

so it was with some nervousness that I

noted several climbers armed with what's

needed - two technical ice tools - to climb

Chèré.

I stiffened and widened my elbows, which

supposedly allows you to gain an inch on

your neighbour, as the bin arrived at the

top. The door opened to a flurry of climbers

bursting forth and running to the start of the

ridgeline, which guards access to the entire

mountain range.

There was no time for faffing. My climbing

partner Chris and I donned our crampons,

roped up, and launched onto the ridge. The

twin ice-tooled party was directly behind us

as we broke trail to the base of Chèré. But

it was my first time at this altitude in years

- the equivalent of Aoraki’s summit - and

with fresh snowfall to plough through, it took

some effort to stay in front. They followed us

all the way to the start of Chèré, and then

started climbing right behind us.

It was my first time ice climbing in years,

and it was fantastic to throw serrated ice tool

blades into the snow-covered ice. I soon

found my rhythm, but I was in a rush, not

wanting to hold up any of the climbers in our

wake.

Ice climbing below another party is

considered foolish because it’s asking to be

smashed in the face by falling ice. Not so in

Chamonix, where it’s apparently standard

etiquette to gang-bang classic routes,

regardless of the consequences; the team

behind us were already being pelted by

falling ice debris.

We made quick work of the climb, and

instead of plugging up the long snow-slope

to the top of the mountain, we decided to

abseil. This is also standard etiquette in

Chamonix, even with several climbers below

who were forced to dodge falling ropes as

we pulled them from abseil point to abseil

point. There were still eight climbers on the

route by the time we arrived back at the

base, with two more about to start.

It was only 11.30am, so we made our way

to another classic: Cosmic Arête. There

were, predictably, at least 20 climbers on it

by the time we got there. Most of the route

isn't too demanding so we climbed ropeless,

scrambling up chutes and crests of granite

while ducking in and around other climbers

and their ropes.

It’s the enviable infrastructure that enables

such access to these famous mountains.

The cable car takes thousands of people to

the top of the Midi everyday. For climbers,

it all but erases the long and arduous

approaches that most alpine climbing

requires.

"Ice climbing below

another party is

considered foolish

because it’s asking

to be smashed in

the face by falling

ice. Not so in

Chamonix, where

it’s apparently

standard etiquette

to gang-bang

classic routes,

regardless of the

consequences"


Above: Serenity greets a climber topping out a gendarme in the Central Darrans, northern Fiordland, with the Mt Revelation and

Taiaroa Peak on the left and Mts Underwood and Patuki on the right, above the Taoka Icefall.

The Midi gondola is only one of several in the Chamonix

valley. There’s one that takes you to the top of Le Brévent

(2525m), from where you actually walk downhill for 20

minutes to get to the base of the 300m-high rock climbs.

And the Flégère gondola and Index chairlift deposits you, at

2595m, at the base of the Aiguille Rouge range.

But this also transforms one the world’s best places for alpine

climbing into a complete cluster.

It couldn’t be more different in New Zealand, where it’d be

unusual to see other parties in the country’s best mountains

for alpine rock climbing. The Central Darrans, in northern

Fiordland, encompasses the peaks in the Te Puoho cirque,

as well as those surrounding Lake Turner, including the

ridgeline from Mts Patuki to Madeline. The area is gifted

with vertiginous and glaciated walls of hard rhyolite, which is

much more compact than the schist that dominates most of

the Southern Alps.

But getting there is a tad more challenging than standing

in a gondola bin for 20 minutes. Tales of extreme tramping,

known among Darrans climbers as ‘danger-walking’, is

enough to deter anyone from going there. A couple of friends,

for example, ended up taking their ropes and climbing gear

for a massive walk; they managed to get to the fabled bivvy

cave known as Turner’s Eyrie, but it took them two days and

several close shaves to get there, and they needed the third

day to rest before walking out on day four.

The best way in is a matter of debate, but they all invariably

involve snow and glacial travel, rock scrambling, and the

unique Darrans experience of near-vertical plant-pulling.

Our route - from the Lower Hollyford River to The Eyrie in

one push - was a 17-hour day: bush-bash up to Rainbow

Lake from the Hollyford valley, scramble over a col near Mt

Tuhawaiki, drop under Mt Taiaroa, gain and then negotiate

the Te Puoho Glacier to another col, ease nervously down a

tenuous slope known as Lindsay’s Ledges and, finally, cross

to the Karetai-Patuki col and stumble up the final stretch.

By the time we crawled into The Eyrie, etched into the

northwest side of Mt Karetai, it was 11pm. We were fried. My

climbing partner, Jimmy, only made it through half his dinner

before nodding off, still half-seated in his sleeping bag.

The rewards, though, are immediate. The Eyrie looks out

to the snow-capped towers of Tutoko and Madeline and the

rocky spire of Te Wera. We spent a week exploring, including

twice climbing a 300m-high cliff face, scrambling the south

ridge of Te Wera and the north ridge of Karetai, and reaching

the summit of Mt Underwood via the Taoka Icefall.

And all to ourselves. All I knew in the aftermath of the trip

was that I had to return to such a unique place - the country's

most exquisite, with infinite rock and adventure to be

sampled.

It also made me consider the pros and cons of a lack of

infrastructure. Part of the magic of the Central Darrans is

how empty and wild it is. It would be a completely different

experience if there was gondola access, and crowds of

climbers at the base of every rock wall.

But getting there is no picnic. One of New Zealand’s best

climbers told me he has no inclination to explore the area

because of the walk-climb ratio, as in, heaps of ‘dangerwalking’

and relatively little climbing. I didn’t really understand

until I was in Chamonix, where there are massive clusters of

climbers, but the ratio is flipped.

The advantages were never more starkly obvious than when

my climbing partner and I arrived at the south face of the Midi

one morning. Our stiff elbows had helped us to be the first

ones there, and we started unpacking our climbing gear just

as the sun’s first rays enveloped the tower of granite in front

of us.

My stomach turned nauseous, however, when I realised I’d

left my climbing shoes at home. I sprinted back up the snowy

ridge, took the gondola down, raced through town and up

a hill to our apartment, grabbed my shoes, barreled back

down the hill, and stood in a sweaty mess while catching an

ascending gondola bin.

Where else in the world can you rush home to retrieve a

forgotten item and be back at the base of a granite wall,

3700ish metres above sea level, within an hour?


Right: Jimmy Finlayson enjoying the

solitude of the Central Darrans on the

north ridge of Karetai Peak.

"Part of the magic

of the Central

Darrans is how

empty and wild

it is. It would

be a completely

different

experience if

there was gondola

access, and crowds

of climbers at the

base of every rock

wall. "


EXPLORING

ARTHURS PASS

NATIONAL PARK

Words and images by Eric Skilling

It’s taken several millennia of earthquakes and glacial

erosion to create the impressive landscapes of Arthurs

Pass National Park, making it a trampers paradise.

From expansively wide, rock-strewn valleys of the

Waimakariri, to gut-busting tracks up forested ridges

with the reward of expansive views of jagged peaks and

glaciers. Within a single day you can clamber up steep

and narrow paths through tranquil beech or podocarp

forests, take in epic views from the top of rocky peaks,

refreshing yourself with the ancient waters of ice-cold

glacial streams. Then cruise home on wide-river flats

alongside those crystal-clear rivers.

Glaciers up to 1,000 metres high have done some

serious and not very subtle sculpting here. Thankfully

several eras have passed since nature’s colossal

earthmovers retreated, allowing the rivers and streams

time to do their bit eroding the tops and depositing

thousands (perhaps millions) of rocks into those steep

valleys. This sets the scene for a huge variety of outdoor

challenges in a relatively small area.

ADVENTUREMAGAZINE.CO.NZ//19

Above: Beginning our descent from Carroll Hut. Far right: Emerging out of the bush with views of the Otira Gorge below.

Inserts: Clambering our the way to Carroll Hut / Stunning alpine bush surrounded Carroll Hut / Enjoying the warmth and comfort of Carroll Hut

Like all Alpine areas, you need to come

well prepared in terms of gear and fitness.

Back in the 90’s a group of us completed

the famous Minga-Deception track during a

cold weekend in late May. On that trip one

of our party hit the proverbial wall several

hundred metres short of the hut. We had to

split his gear amongst three of us and coax

him up the valley to the hut. Next day was a

slog out onto river flats in sleet which turned

to snow just as we reached the car park.

This trip was a complete contrast. We had

based ourselves in Arthurs Pass township

for 9 days over Christmas and New Year,

and even after a full week of exploring, I left

regretting we hadn’t planned a longer stay.

A day-walk to the top of Bealey Spur and

an overnight trip to Carroll hut are probably

two of the best and most contrasting

trips that will whet your appetite for more

adventurous trips in the park, such as

Avalanche Peak (see January issue –

“Decent to Crow valley – the scree slope

from hell”).

The Isolation of Carroll Hut

(3-4 hours each way)

If you find yourself standing on the Otira

lookout north of Arthurs Pass village, take

time to lift your gaze over the viaduct and

the ridges of the Barron Range to a small,

scooped hanging valley in the distance.

It’s heavily- forested headwall plummets

some 500 metres into the Otira Gorge

below. Looking closely, you can see the

tiny light brown spec of the 10-bunk Carroll

Hut looking isolated, frail and insignificant

against the magnificently rugged peaks

and steep glacial valleys surrounding it.

It is difficult to comprehend the contrast

between this track on the west and Bealey

Spur to the east. For starters the trail

begins with a river crossing which will test

the quality of boots and gaiters.

Gone was the wide meandering path of

Bealey Spur. At the start the narrow rocky

path is almost hidden by overhanging

shrubs and ferns which soon widens,

but also gets a lot steeper. For the next

few hours we scrambled, scaled and (for

some) swore our way up an endless series

of head-high (and higher) rocky or muddy

ledges, searching for hand and footholds.

The foliage was a dense mass of gnarled

podocarps with numerous other broadleaf

shrubs. A few sweaty hours later the

canopy above began to thin out, allowing

some sky to peak through. Mount Cook

lilies and daisies appeared on the side of

the narrow path as it widened and started

to traverse across the face of the ridge.

At this point we got our first views of the

spectacularly steep and narrow Otira

Gorge way below us and across the valley

to the Barron Range, it’s ridges scarred by

scree-slopes. The vegetation was steadily

changing again to a mix of snow tussock

and other alpine shrubs. Up ahead the

track disappeared into the occasional mist.

It was getting much cooler.

Carroll hut came into view, looking fragile

and isolated in the expanse of the cirque.

The surrounding peaks were barely visible

in a lumpy cloak of damp, swirling mist.

Painting the hut a creamy brown looked

like an attempt to make it blend in with

the rugged beauty of the tussock and bog

pine in the cirque. Instead, it seemed to

look more foreign and out of place with its

straight edges and dark framed windows.

Once inside it was a different story.

Sleeping bags were unpacked, gas

burners hissed, lunches, coffees and teas

made, and the banter and chatter began.

Outside the weather clagged in, and no one

mentioned anything of the original plans to

venture to the tarns and peaks behind the

hut. It was a pleasure to spend the rest of

the day in the cosy, spacious hut.

Next morning, the weather hadn’t exactly

cleared but the rain had moved on. The

group packed up and then several of us

rugged up in beanies and rain jackets and

walked over the ridge behind the hut and


Above: Beasley Hut before taking on the tops / Insert: Grace getting in touch with Aaron's beard

into the mists to try to find the tarns and

Kelly Saddle. About 15 minutes later we

were standing on the saddle where we

should have been able to see down to the

Taipo River valley. Instead, we stared into

the eddying mists in vain before turning

back and heading for the tarns.

The botanist in our group was like an

eccentric professor as she explored the

prolific variety of flowering plants that

survive in these unique environments.

A pair of nesting wren chirped their

annoyance at our invasion. You could only

wonder what they thought when one of

our group stripped down to her togs and

waded in for a quick dip. Crazy.

Eventually we moved on back to Carroll Hut,

picked up our packs and began the descent.

I don’t think our botanist noticed us leave.

This a short but quite challenging trip, but

an overnight stay at the hut is well worth

the effort. I believe the views are also

spectacular, but the mist never cleared

during our stay so I will have to wait until

after my next visit before I can comment.

Recovery on Bealey Spur

(4-5 hours return)

A few kilometres south of Arthurs pass

village, Bealey Spur offers awesome views

for the effort involved getting to the top.

Perfect as an introduction to the area, and

as a warm-up after that long lockdown. It is

an exception to the flat-or-steep-and-notmuch-in-between

rule. Mostly.

The track begins a with wide path that

makes a steady climb through native

beech forest. Most of the trees are well

spaced and only a few metres tall, with

plenty of groundcover. Mosses and lichens

such as Aaron’s beard are everywhere.

Thick pockets of manuka line several

clearings where you get to enjoy the wide

expanse of the Waimakariri valley. We

did get to enjoy the call of the occasional

bellbird and the company of a robin, but

birdlife is sparse.

Bealey Spur hut on the edge of the bushline

is worth a brief stop. This bright green

corrugated hut is full of character with

an earth floor, bunks made from wooden

beach-tree and sacking and a tin fireplace.

On our trip a young family had moved into

the hut, filled the shelves with a weeks’

worth of food, and were using it as a base

to explore the region. A great way for young

ones to experience the NZ wilderness.

Once past the hut the terrain changes to a

boggy tussock and bush slope which then

opens-up giving a full view of a towering

Bealey Spur above. At that point two of

our party took one-look at the steep track

ahead and threatened to bail. To be fair

it didn’t take much to persuade them to

continue onward.

We took our time, and it wasn’t long before

they were distracted by the views. The wide

spread of the Waimakariri valley below us

lined with those steep bush-clad ridges. Mt

Foweraker and Dome (1945m) dominated

the skyline to the east, but the landscape to

the west is far more impressive – the jagged

summits and ridges of Mt Bealey, Stewart

and Damfool (2030m) and Mt Rolleston

(2275m) dotted with pockets of ice and the

occasional small glacier.

Around midday we reached the rock cairn

a few hundred metres along the spur. A

perfect spot to take a break to enjoy the

views. I don’t think I would be out of line

saying that the two of our party who had

been intimidated by the climb were now

looking very pleased with themselves.

There is plenty of time for a quick diversion

to the Bealey Hotel on the way back, to

take in the priceless views from the lounge

and to enjoy a refreshing ale and perhaps

dinner – if you have booked.

With thanks to Backcountry Cuisine,

Jetboil, Macpac and Keen.


We are

the mountain

people.


for Everything climbers. we Each make piece is designed is crafted by by climbers, peak

and for climbers. crag to give Each you piece absolute is crafted protection, by peak

comfort and crag and to give mobility you absolute when you protection,

really need it.


WWW.RAB.EQUIPMENT

WWW.RAB.EQUIPMENT

Available now from Rab specialist stores throughout NZ.

Hunting And Fishing New Zealand Available stores now nationwide. from Rab Auckland: specialist Living stores Simply, throughout Waikato: NZ. Trek N Travel, Equip Outdoors,

Hunting And Fishing Taupo: New Outdoor Zealand Attitude, stores nationwide. Wellington: Auckland: Dwights Outdoors, Living Simply, Motueka: Waikato: Coppins Trek Outdoors, N Travel, Equip Outdoors,

Nelson: PackGearGo, Taupo: Outdoor Kaikoura: Attitude, Coastal Wellington: Sports, Christchurch: Dwights Outdoors, Complete Motueka: Outdoors, Coppins Greymouth: Outdoors, Colls Sports,

Nelson: PackGearGo, Hokitika: Kaikoura: Wild Outdoorsman, Coastal Sports, Wanaka: Christchurch: MT Outdoors, Complete Queenstown: Outdoors, Small Greymouth: Planet. Colls Sports,

Online: huntingandfishing.co.nz, Hokitika: Wild Outdoorsman, dwights.co.nz, Wanaka: outdooraction.co.nz, MT Outdoors, Queenstown: mtoutdoors.co.nz, Small smallplanetsports.com,

Planet.

Online: huntingandfishing.co.nz, equipoutdoors.co.nz, dwights.co.nz, outdooraction.co.nz, gearshop.co.nz, outfittersstore.nz

mtoutdoors.co.nz, smallplanetsports.com,

Distributed equipoutdoors.co.nz, by Outfitters 0800021732

gearshop.co.nz, outfittersstore.nz

www.outfitters.net.nz

Distributed by Outfitters 0800021732 www.outfitters.net.nz

#2

Old Man Hut, Mt. Richmond Forest Park (spot the campsite clearing in the background)

BILLION STAR

OVERNIGHT

STAYS

By Eric Skilling

Overnighting in 6-star hotels and resorts must be a memorable

occurrence, but I wouldn’t know. I do know about 5-star accommodation

thanks largely to a past life in the corporate world, but the funny thing is I

struggle to remember any details of those stays.

But when it comes to tenting out after a day’s tramping, I can recall great

details of every experience. OK, I must admit that a couple of those nights

I wouldn’t like to repeat, but the vast majority have been unique and

unforgettable stays that I often reflect on, appreciating how lucky I was to

have had the opportunity.

What makes a campsite a great place? For me, unashamedly biased as

they are, I have chosen to rate on these five criteria that are important to

me.

#1: Abel Tasman National Park.

Dawn Chorus 8 | Setting 9 | Sunrise 10 | Sunset 5

Accessibility 10

There are many reasons why the beaches on the Abel

Tasman walk are rated amongst the best in the world.

Usually small and horseshoe shaped, these sheltered

bays are lined with steep ridges clad with native bush,

making a stunning contrast with the golden sand on the

beaches and unbelievably clear blue waters.

Imagine nodding off to sleep as gentle waves slap the

beach just metres away from your tent. Then waking to

the shrill call of a weka and the one-bird orchestra of a

bellbird perched in the tree above your tent. And later,

while still lying in the comfort of your sleeping bag, watch

the horizon turn orange, red and silver.

Choose to enjoy the wide rolling track or if you want to

share this with non-trampers, just catch a water taxi. And

this is one of the few places you can enjoy a sea swim

followed by a freshwater shower. Bliss.

Dawn Chorus: Alarm clocks are nobody’s friend but waking to the

calls of our native birds are probably the single thing that will guarantee

making the list of favourite places to stay. This puts both Abel Tasman and

Richmond Forest Park amongst the best.

Setting: Enjoying a hot meal high above a valley floor with views across

rugged peaks will always make for a memorable night. Remoteness,

ruggedness and sometimes, the chance of having the place to yourselves

are all important. Carroll Hut sits high up on this rating.

Sunrise: One of the most memorable moments I have had was sharing

a golden dawn over Tasman Bay while still snuggled up in sleeping bags

with someone special. On this occasion a weka meandered nonchalantly

mere feet away from our tent, happily engrossed in finding breakfast.

Sunset: Sometimes you find yourself in some idyllic spot where the

morning sun is hidden from you, but the dusk can be just as, or even

more spectacular. Having the chance to watch the sky change colour,

darken and then become sprinkled with a billion stars is a priceless

experience that I never seem to enjoy unless I am out tramping.

Accessibility: As we also know, shared experiences are often the best.

Sometimes you need to put in the grunt to get there, which can limit

who you get to share these moments with, but some can be shared with

inexperienced trampers, or occasionally you can just get the water taxi.

These are some of those places ranked from the very best to just great.

#2 : Old Man Hut, Mt. Richmond Forest Park

Dawn Chorus 10 | Setting 8 | Sunrise 5 | Sunset 9 |

Accessibility 5

If you wanted to hear the morning birdsong as I imagine

many New Zealanders took for granted several decades

ago, this must be the closest we can get to it today. It

was so loud and prolific that I gave up trying to work

out which birds made up the refrain. Robin, tui, bellbird,

weka and so many others competed to welcome in the

day. Quite a difference to the evenings when the silence

was broken by the gentle hoots of morepork.

Nestled in a large clearing surrounded by beech forest,

Old Man hut is towered over by Little Rintoul. Here a

meal can be had while the sun’s shadow creeps up the

slopes of Little Rintoul, turning the rocky face all shades

of red.

Getting here is a bit of a challenge but so worth the

effort. The compensation is the route climbs up through

a well-established podocarp forest and then cool beech.

You will be cheered along by many native birds, and

there are plenty of cool streams crossing the track. Once

on top of the ridge, the views across the Richmond

range are alone worth the exercise.


#3

Kiwi Saddle Hut, Kaweka Mountain Range

#1

Abel Tasman National Park

"Thanks to modern tents and sleeping bags, more and

more of us are getting out there and discovering the thrill

of overnighting in places as special as these. I know there

will be even more exceptional and memorable locations

that others can name, but at the end of the day we just

need to get out there. And most adventures are even better

when they are shared."

#3 : Kiwi Saddle Hut, Kaweka Mountain Range

Dawn Chorus 6 | Setting 7 | Sunrise 7 Sunset 9 Accessibility 7

Where else can you view nightfall in a blaze of colours over the rugged

profile of Mount Ruapehu and at the same moment a full moon slides up

over the vast expanse of Hawkes Bay. Then next morning, witness the

first rays of dawn light sparkle on the Pacific Ocean.

Also placed in a beech forest, it’s a short walk from the tent sites to the

exposed ridge with wide vistas east and west. Plenty of hard work is

going into making this forest a haven for birds. Trapping is widespread

and the results are already obvious.

#4

Caroll Hut Arthur's Pass National Park

#5

Caves Campsite, Whatipu

#6

Bog Inn, Pureora Forest Park

#4 : Carroll Hut, Arthurs Pass National Park

Dawn Chorus 4 | Setting 9 | Sunrise 5

Sunset 8 | Accessibility 7

My enduring memory of the visit to this site was

the feeling of solitude. This is a bit hard to justify

because it is only 3 hours hiking from a sealed

road. At night you can see the glow of reflected

light from the township some 500 metres below.

Located on the West Coast side of Arthurs Pass,

in a wide and exposed hanging valley with a

precipitous drop to the Otira Gorge. Perhaps the

feeling of remoteness comes from thick but low

alpine shrubs that surround the camping area,

offering little cover if the weather turned foul.

Perhaps it is also the expansive views across

the valley to the jagged peaks which gives a

feeling of settling down high up in the mountains.

Whatever the reasons, overnighting here will be

a memorable experience for anyone who can

appreciate it.

Typical of the West Coast, the track begins in

lush and humid forest. The first two or so hours

are steep with plenty of exposed roots and

some treefall to negotiate, but well within the

capabilities of most trampers. And it’s only 3

hours.

#5 : Caves Campsite, Whatipu

Dawn Chorus 3 | Setting 8 | Sunrise 5 | Sunset 9 | Accessibility 8

The rugged west coast is full of unique and unforgettable places to explore. Even

though this site is some distance across a wide expanse of sand dunes from the

beach, the distant roar of those huge swells exploding onto the beaches helps make

this a special place. A rugged cliff to the east of the site is covered in huge cabbage

trees, nikau palms and flax bushes, adding to that wild-west-coast feeling.

There is no hint that a huge metropolis sits just a few miles to the east as the crow

flies. The trail itself is a relatively easy walk from the car park, past the famous

Whatipu Caves. Be aware that there is no water, so plan to lug in a few extra kilos.

#6 : Bog Inn, Pureora Forest Park

Dawn Chorus 3 | Setting 8 | Sunrise 4 | Sunset 3 | Accessibility 7

Ancient. That is the overriding feeling as you settle back for the night in the heavily

wooded site alongside Bog Inn. The history of the area is a mix of plunder, extreme

hard work and endurance, followed by conflict, sacrifice, financial hardship, and

heartache. Thankfully though the final chapter is one of considerable foresight

which we can get to enjoy and value.

When forestry activities were halted all those decades ago, with the obvious impact

on the local economy and those who survived off the industry, it left behind some of

the most ancient trees now standing in New Zealand. Be inspired by the massive

matai, rimu, totara and miro – mere seedlings in the 13th century. When it comes

to “forest bathing” Pureora can’t be beaten.


A KIWI

ON

THICK

ICE

Words and photos by Ash Routen

For a few months a year, the world's

largest volume freshwater lake freezes,

providing locals and visitors the chance

to walk across its surface. Following in

the steps of a few previous trekkers,

Ash Routen travelled to Russia in 2018

to walk across the frozen surface of

Lake Baikal.

On a cold and overcast afternoon

in a small lakeside resort in Siberia,

my friend Phil and I clumsily drag

our plastic sleds down a small set of

stairs to the frozen surface below. Our

farewell party consists of Eugene, a

local trekking guide and our trusty fixer,

and two Brits, Robbie, and Natalie, who

are new acquaintances.

An hour before, we had been basking

in the comforting warmth of a trendy

local café. "You two look like a right

pair of f****ers," Robbie had quipped

with his strong London accent. I was

glad we at least looked the part, given

we would soon be leaving behind the

sanctuary of the café for a long cold

march ahead.

Trace a finger roughly north of

Ulaanbaatar, the capital of Mongolia,

and you soon hit a vast body of

water. Tucked between mountains

and Siberian hinterland, Lake Baikal

stretches for nearly 700km. Its frigid

depths plumb to a little over 1.6km.

Remarkably, the lake freezes over in

February and March, just enough to

allow a few hardy (or stupid) souls to

walk on its surface.

Heading north on windblown

ice. The surface offers little

resistance for sled hauling.


"Once you overcome

the initial fear of deep

cold, you almost learn to

love it. It renders the air

crisp and clear. Ice and

snow crunch pleasingly

underfoot. And the light

takes on a different

ethereal quality."


First steps on the ice: I had hoped to

see the curious shapes and methane

bubbles that marble the lake's windblown,

frozen surface, but that first afternoon on

the ice, we were met by compact snow

fields. Phil strode ahead for the first few

hours as I chatted to Robbie and settled

into my 'polar plod.' Elite ultra-runners

Robbie and Natalie were here to scope

out the possibility of running across the

lake in the future. Phil and I simply wanted

to amble across the thing before our

tourist visas expired.

We had arrived at the shores of this winter

curiosity after an intense six months of

sourcing equipment, acquiring visas,

planning the route, and squeezing in some

much-needed training. The latter was

undoubtedly required as I was exchanging

a sedentary office job for twenty-odd days

of pulling two plastic sleds, choc full of food,

fuel, and other necessities. The sleds would

be our lifeline as we trekked across Baikal,

from a small resort village in the southwest

corner to the penultimate settlement in the

north - a journey of some 640km.

The first night on the ice, and the next few

after that, took some getting used to. It

was now just Phil and I, and the twinkling

lights on the shore were distant. Beneath

our sleeping mats, the floor creaked and

groaned. The ice was solid enough that we

had difficulty driving in ice screws to pin

our tent down, but it also appeared to be a

living, breathing beast. Subtly piercing the

overwhelming silence, the faint, haunting

sound of the groaning ice below almost

sounded like shelling on the western front.

This was to be our nightly soundtrack for

the coming weeks.

Life in the freezer: Our plan was to snake

along the lake's western shoreline, only

deviating to navigate around the large

mass of Olkhon Island at more or less

the halfway mark. During the first five

days, we slowly found our rhythm and

were zipping along nicely, reaching close

to 30km of walking on some days. We

strapped small micro spikes to our boots

to gain traction on the bullet-hard ice.

Still, despite being unwieldy and heavy, I

preferred to use my snowshoes as they

dug harder into the surface.

In March, the lake is reassuringly cold,

with the mercury regularly dipping to -20c

and below at night. Thankfully we slept

soundly in our big puffy arctic sleeping

bags. Once you overcome the initial fear

of deep cold, you almost learn to love it.

It renders the air crisp and clear. Ice and

snow crunch pleasingly underfoot. And the

light takes on a different ethereal quality.

During the day, the cold was less of a

worry, as the heat from our movement

kept us warm. Ironically sweat is the

enemy of a cold weather traveller, as it

freezes on your clothing and drops body

temperature. So I was constantly fiddling

with layers, vents, hats, and gloves.

Endless faff.

To the outsider, sled hauling and the

relentless monotony of one step after

another might seem like torture. On

some days, it is. On those days, all you

can do is cinch down your jacket hood,

put your goggles and face mask on and

drive into the biting wind, only looking

up occasionally to scout the way ahead.

But on clear sunny days, it's close to

perfection. The internal battle is replaced

by an overwhelming sense of freedom

as the horizon melts into an endless

expanse.

"I felt like a frontiersman

riding into town during

the expansion of the Wild

West, but thankfully we

weren't met by a guntoting

local sheriff."

The winds on Baikal can be merciless.

On our third full day, hoods were most

definitely down. My goggles repeatedly

fogged over as I worked hard against

the headwind. I tried not to slobber as

I breathed heavily into my ice-stiffened

facemask. No time to stop for long with

the temperatures dropping to 30 below;

just keep moving forward and shovel in a

handful of goodies when you can. We only

made 14km that day, but the miles soon

flew by as the weather was mostly kind

to us.

By day nine, we had sighted the jagged

bulk of Olkhon. "Let's aim for the darker

brown patches to the right," suggested

Phil, "I'll meet you there." Despite being

twenty years older, Phil was in better

shape, so most of the time, during clear

weather, he would take off ahead and

meet at the end of the day. A risky strategy

given we had no radios and I usually

carried our one satellite phone - but it had

worked for us so far and meant we could

both travel at our own comfortable pace.

I had met Phil two years earlier on a polar

training course in Norway. Tall, bearded,

and with a smattering of tattoos, he could

look a little menacing. But I soon learned

he was a gentle soul. Empathetic and

kind, but also tough and very driven. The

sort of person you know you can rely on.

That counts for a lot in the wilderness.

The more I walked, the more I doubted

our plan for the day. We wanted to ‘thread

the eye of the needle’ and navigate

between the mainland and Olkhon's

western flank. Things didn't seem to

add up, though. As the day wore on, the

darker brown side of the island looked too

far to the right to be the passage we were

aiming for.

My feet were screaming from days of

being bashed on the hard ice, and the

sun was dropping ever lower behind the

mountains. I scanned the horizon for Phil.

He had the tent. "Trust yourself, Ash," I

muttered to myself. "Trust the map."

I took a bearing and headed left of the

darker hills, assuring myself that Phil must

have come to the same conclusion. The

negative part of my brain was mulling over

the prospect of a night out in the open,

huddled inside my sled bag, with as much

clothing as possible. That was definitely

not a pleasant prospect.

But just as I began to fear the worst, I

spotted it – our tent - a tiny dark fleck on

the horizon. The pain in my feet melted

away, and I pushed onward, celebrating

and muttering to myself with musings I

have long since forgotten.

A changing landscape: The shoreline of

Baikal isn't without life or interest. Lumpy

rolling hills covered with deep snow and

generous smatterings of dense woodland

filled much of our view before Olkhon.

The ice itself drew us in with its natural

artistry. Trapped methane bubbles and

sweeping white swirls were frozen into

translucent sheets with hypnotic effect,

and the broken ice forced upward by

pressure twinkled with blue and emerald

tones. There were also occasional

Dacha's, wooden summer houses for the

rich or visiting tourists. Olkhon has several

dwellings on its shores, and we took up

the hospitality of one friendly hotelier to


Top to bottom: Sunrise

through a blade of ice.

A typical camp spot, with the

mountains of the east coast

of Baikal in the background.

Home for a night, a small hut

at a weather station on the

west coast of Baikal.

"Subtly piercing the

overwhelming silence,

the faint haunting sound

of the groaning ice below

almost sounded like

shelling on the western

front. This was to be our

nightly soundtrack for the

coming weeks."

escape into the warmth and refuel. Never

have black tea, honey, bread, and a bowl

of plain white rice tasted so good.

The character of the landscape began

to change after this. Undulating lumps

gave way to huge alpine giants. Steep

buttresses and gullies soared high into

the deep blue sky, and the loose snow

danced around these features as the

wind buffeted their upper flanks. Although

local mountaineering clubs do access

these remote ranges, there are no doubt

many lines that remain unclimbed.

Endless beckoning nothingness to

the right and jagged alpine mountains

piercing the skyline to the left. Now, this

was why I was here.


Interesting encounters: After 15 days

of travel, we had covered nearly 450km.

We happened across a series of remote

huts, one of which was inhabited by a

hardy couple who manned a weather

station. Forgetting any notion of purism,

Phil and I took up the offer of a night

in a small wooden hut. The following

day I started off early and waited for

him to catch up. The catch came much

later than usual, though. A brown bear

had arisen early from hibernation and

descended on the weather station. No

big drama, though, as the sore-headed

bear was chased off by a few warning

shots from our weather station friends.

The wildlife weren't the only interesting

characters on our journey. There were

the locals too. One day out of the haze,

a pair of battered old Soviet vans came

careering toward me on the ice road

that lines part of the lake. "Oh Christ,

what the hell do they want?" I thought.

After screeching to a halt, a great big

bear of a man stepped out. Chattering

away for a moment, he realizes my blank

face means I can't understand what on

earth he's saying. He quickly switches

to English and hurries his clients out of

the van. Before long, I'm surrounded

by tourists asking for photos, as if I

were some kind of curiosity. I must

have looked like a stereotypical "Polar

Explorer" with a fur ruff on my hood and a

weather-beaten face.

After asking where I lived in the UK, an

Austrian chap even managed to talk

about my local soccer team who had

just won the league. But soon enough,

I was thanked for my photographic and

conversational duties and treated to a

shot of local samogon (moonshine). Not

one, however, but three. I daren't decline

their gesture, so as we went our separate

ways, I tottered on, feeling bemused and

a little worse for wear. What on earth had

just happened?!

The home strait: After a few weeks, life

on the ice becomes ingrained. You forget

what it was like before, and you don't

want to imagine what it will be like when

you reach the end. While striking camp

in the morning may have taken several

hours, it now took half the time. The

disciplined routine of cold weather travel

becomes second nature. The ice, wind,

and snow become your entertainment.

Their distinct moods lift or sully your own.

To the indigenous Buryat people and

those who spend a lot of time on the

lake, Baikal is an extraordinary place. "I

physically feel how the positive energy of

Baikal recharges my batteries. For me, it's

not just the biggest freshwater lake – it's

part of my inner world," our fixer Eugene

told me. Several times in his life, he had

attractive job offers in other countries,

and I could now see so well why, on each

occasion, he had turned them down.

The final few hundred kilometers were

not easily won. The snow was deep in

the latter half of the lake, and even with

snowshoes, we struggled. Eventually, after

19 days and 634km, we reached the end.

We trudged into Severobaikalsk, a slightly

grim and rundown town built for workers of

a new railway line in the mid-'70s.

We dragged our sleds onto the main

road into town, past abandoned lakeside

summer houses as the odd mangy dog

or local resident looked on curiously. I felt

like a frontiersman riding into town during

the expansion of the Wild West. Still,

thankfully we weren't met by a gun-toting

local sheriff. As we had found repeatedly

throughout our trek, the people who live

along the shoreline are warm, generous,

and very hospitable.

And just like that, our Siberian wander

was at an end. We spent the next 36

hours chugging past endless taiga on the

Trans-Siberian railway and other lesserknown

lines. A dream safely fulfilled, our

bodies could now relax. We ate, drank,

laughed, and felt satisfied. Despite the

warm toasty sanctuary of our carriage,

I knew before too long we'd both want

to be back out on the ice. Once you

experience this winter pearl of Siberia, it

becomes part of your inner world.


Phil breaking trail on a hazy day

"After a few weeks, life

on the ice becomes

ingrained. You forget what

it was like before, and you

don't want to imagine

what it will be like when

you reach the end."

BIG PINE LAKES

Words by Paige Hareb | Images by Lauren Murray

While spending two months in America, Lauren and I wanted to do a few road trips

and hikes to explore more of this amazing, huge, crazy and beautiful country. One of

our adventures that really stood out, and we would definitely recommend doing was,

commonly referred to as the Big Pine Lakes trail, the technical trail name is Big Pine

Creek North Fork Trail.

Big Pine Lakes is located in the heart of the Eastern Sierras of California. It is roughly 10

miles (yes miles cause we are in America now folks! About 16kms) west of Big Pine and

around 15 miles (24kms) south of Bishop. It’s not far from the ski town, Mammoth.


Standing here in this moment, made the previous 3 hours all worth it.


"We asked if we

should buy some

bear spray (yes,

that’s an actual

thing!), but

again, we felt like

they laughed at

us two girls with

funny accents. "

Although we didn't manage to get a photo of the bear on

this hike, a week later we were in Sequoia National Park

and had more time and distance to capture this shot.

We wanted to slowly make our way up and camp

up there overnight but you need to get a permit

for that. To get these you have to plan in advance,

which we aren’t great at doing! So the only 25

permits per night were already booked out. With

Lauren being a professional photographer, she

wanted to make sure we were there for good

lighting, which means either for sunrise or sunset.

Either way, we would have to do a lot of the trail

in the dark. Not my favourite thing to do, let alone

adding bears into the mix!

Because we felt like such innocent, naive little

kiwi girls, we decided to double check at the Inyo

National Park information centre as well as a

hiking store nearby to see what the actual odds

were like of coming across a bear and being

attacked by one. The general answers from them

felt a little bit like when people ask me “have you

ever seen a shark when surfing?” and my answer

is usually a slight laugh with something along the

lines of “yeah, but for the amount of surfing I’ve

done, not that many times and you’re more likely

to have a car accident”. One of their answers was

“you’re more likely to get struck by lightning”. We

also asked if we should buy some bear spray

(yes, that’s an actual thing!), but again, we felt like

they laughed at us two girls with funny accents.

So on that note, we decided to hike up for sunrise.

Bishop is the closest town, about a 30min

drive to the start of the trail, we were already

needing to get up at 2am so decided to stay at

the campground right by the trailhead to get that

extra 30mins of sleep. We knew it would roughly

take us 3 hours up to be safe and arrive with

enough time to set up for sunrise. With no one

else silly enough to get up at that time of the day,

we headed off into the pitch black early hours of

the morning with our head lights on and having

turns at carrying a mini axe, because we had

still scared ourselves about bears and somehow

thought a mini axe would protect us (now that

I’m writing this, I’m embarrassed and laughing at

myself).

With our head lights on, an axe in hand, we were

on our way and still very on edge. The first part

of the trail was a steep rocky and sandy incline

which we felt but coming back down it in daylight,

we both agreed that seeing where we had to climb

up would have been a lot more disheartening. I

think it’s the first hike we have ever done where it

took us the same amount of time climbing up as it

did down (2.5hrs up and 2.5hrs down).

The only explanation we can think of, is that we

were so wired from adrenaline walking up in the

dark and thinking about bears. My neck actually

got sore because I was looking all around the

whole 2.5hrs up, even turning around and looking

behind me every 100 metres to double check

nothing was following us. We also talked the

whole way up as it was a bear survival suggestion

to help let the bears know that we were humans.

It was like we had manifested encountering a

bear. About halfway up I was trailing a few metres

behind Lauren when I heard a fairly loud sound.

We stopped in our tracks instantly and continued

to hear the sound of a bear snoring, yes snoring!

It sounded very deep and loud and like it was just

a few metres off the track from us.



"Lauren spotted two

eyes up ahead shining

in our head lights

staring right back at

us. I had just finally

relaxed slightly after

the last one, yet here

we were again stopped

in our tracks having

a staring competition

with a bear."

"We ask

should b

bear sp

that’s a

thin

again, we

they lau

us two g

funny a

Above: Lauren testing the freezing cold water, lake three of seven.

Right: We didn’t get to sleep here but someone did, what a ‘pine’

view to wake up to.

We were standing frozen and whispering

deciding whether to carry on or not. We decided

to tip-toe past and for the next half an hour we

were looking behind us more than ever. My

shoelace came undone but we didn’t even want

to stop for that, just wanted to get as far away

as possible and not wake the sleeping bear.

About 30mins more into the hike, roughly just

over half way, still pitch black, Lauren spotted

two eyes up ahead shining in our head lights

staring right back at us. I had just finally relaxed

slightly after the last one, yet here we were

again stopped in our tracks having a staring

competition with a bear. I never in my life

thought I would be able to say that. Luckily

it was up in the distance but because it was

so dark, we couldn’t tell if it was going to be

on the track up ahead. We stood there for

contemplating turning around. Since we were

over halfway and closer to our destination, I

really didn’t want to turn back in pitch black,

walk past the sleeping bear and not see what

we came here for. But I also didn’t want to get

any closer to this bear staring at us. After what

felt like an eternity, we made a bold decision

to carry on a bit further to see where the track

would take us. Thankfully the next turn was in

the opposite direction of the beady-eyed bear.

I think that’s the most excited I’ve ever been

about seeing the first light in the early hours

of the morning. I said to Lauren several times

“Look, look, it’s getting lighter”. You would not

believe how relieved we were when we saw the

first of the seven lakes up there. The first lake

was beautiful but five minutes more and we

made it to the second lake, the one more well

known for it’s majestic beauty. As you can see

in the photos, it almost looks fake and felt like

we were on a movie set. Yes, the water colour

really is that colour! We thought we were the

only ones up there until the light started showing

a few hidden tents around the lake. We decided

to check out the third lake as it was only another

10 minute walk but it was safe to say the second

lake is definitely the most magnificent. We

would of liked to have travelled further into the

hills but the adrenaline was wearing off and we

still had at least another couple of hours to get

back down, as well as the sun rising quickly to

over 100 Fahrenheit (over 37 Celsius).

With over an 11 mile round trip (18.5km) and an

elevation of 786m, a total 5 hours of walking,

we slinked into the car, thankful for minimal bear

encounters and the amazing scenery, and drove

straight to Starbucks for a well-earned iced

Frappuccino.


ed if we

uy some

ray (yes,

n actual

g!), but

felt like

ghed at

irls with

ccents. "


Paddling 38//WHERE on the ACTIONS Whanganui SPEAK Journey LOUDER THAN WORDS/#234

PADDLE THE

WHANGANUI

JOURNEY

NZ'S ONLY GREAT

WALK ON WATER

Nothing really prepares you for the

magnificence of the Whanganui River. As the

world’s first river to be recognised as a living

entity, a personhood with legal rights, there is

a benevolence in the air, a sacredness to the

waters you can’t deny.

As you navigate your way downstream,

it’s as if time stands still and you are fully

immersed in a new rhythm, with each stroke

of the paddle, all your senses come alive.

Slowly, spectacularly, the natural wonders

unfold, and there is a feeling of divinity that

humbles you, so much so that you feel

you ought to whisper in the stillness of the

morning mist or break out in song at the end

of the day as an offer of thanks.

From the deep dramatic gorges to the lush

evergreen ferns hanging over the riverbanks,

there is something otherworldly about the

Whanganui Journey that’s hard to describe

in words, you have to feel it to believe it.

So pack up your hiking boots and let your

paddle do the walking – the life force of the

Whanganui Journey is calling.

Discover New Zealand’s only Great Walk

on water

Sweeping from the North Island to the

bottom of the South, the ten New Zealand

Great Walks are Aotearoa’s premier tracks

for unforgettable walking, hiking and in the

case of the Whanganui Journey, paddling

in off the beaten track, pristine wilderness.

Soak up the magnificent natural landscape,

wildlife, and the rich cultural heritage of

Whanganui River – NZ’s longest navigable

river at 290 km long flowing from Mt

Tongariro towards the Tasman Sea.


Images compliments of Visit Ruapehu

Clockwise from top left: Misty morning on the Whanganui River / A cultural experience at Tīeke Marae/Kāinga

Mangapapapa Campsite along the Whanganui Journey / Taking a break on the Whanganui Journey

Getting to the start of the Whanganui Journey

There are several traditional entry and exit points in Ruapehu for

the Whanganui Journey including the following:

• Taumarunui

• Ohinepane

• Whakahoro

• Pipiriki

Make the most of your experience and enjoy a night or

two before and after the Whanganui Journey and enjoy

connecting with the local communities. With a a wide range of

accommodation and activities on offer in Ruapehu, it’s easy

make the Whanganui Journey a one-of-a-kind holiday.

How long is the Whanganui Journey?

You can choose to do either the 5-day from Taumarunui to

Pipiriki (145 km) or the 3-day journey from Whakahoro to Pipiriki

(88 km). It’s a journey to savour and not meant to be rushed.

Operators are able to provide shuttle transport back to your

accommodation, vehicles, or starting point.

Tour types – canoe, kayak, guided or unguided

There are several ways to experience the Whanganui Journey,

but the majority of people travel by canoe. Going guided also

gives you a deeper insight to the people of the river, the culture,

history, and way of life. If you are not confident on a canoe nor

a confident swimmer, booking a guided Whanganui Journey is

recommended.

When is the Whanganui Journey Great walk season open?

The Whanganui River is accessible year-round, with jetboating

tours operating in the winter months. However, if you want

to complete the Whanganui Journey, the Department of

Conservation (DOC) has specific dates for when the Great Walk

season runs - generally from 1 October to 30 April where you will

need to book your huts and campsites in advance.

What to pack

You can’t purchase food or supplies on the Whanganui Journey

so pack like you are camping and need to be self-sufficient. Gas

cookers, tents, ground sheet and sleeping mat for campsites,

cooking equipment and utensils, food that doesn’t require

refrigeration and drinking water for until you get to the first

campsite or hut. Pack toiletries including toilet paper, a first aid

kit, survival kit, a distress beacon because there is no cell phone

reception, personal medication, warm clothing, and waterproof

layers. Check out a full list of recommended items on the

Department of Conservation website as well as contact a local

river operator. Local river operators will provide a life jacket,

canoe, or kayak, along with paddles, dry bags, and plastic

drums to store your essentials and gear.

What’s accommodation like?

The Department of Conservation operates two huts, eleven

Great Walk campsites and one basic bunkroom along the

Whanganui Journey. During the Great Walk Season, you must

book huts and campsites ahead of time. A highlight of the

journey is a unique stay at Tieke Kāinga, the only DOC hut that

is also used as a marae. Choosing to book a guided cultural

journey means you will be immersed in the culture and history

with the possibility to participate in a traditional Māori pōwhiri.

There are bunks, mattresses, backcountry toilets, a heating

source and water supply at the huts although you will need to

boil the water first before drinking. For some Great Walk Huts,

a hut warden may be present. Campsites have basic facilities

including a water supply, picnic tables, cooking shelters and

toilets. Read up on the latest information about the Whanganui

Journey from the Department of Conservation (DOC) website or

visit a DOC Visitor Centre.

Care for the Whanganui Journey

Leave only footprints, take only memories. Protecting nature,

wildlife and looking out for others is paramount on the

Whanganui Journey. Respecting the environment means

whatever you take in, you must take out with you. Staying safe

also entails being prepared for variable weather conditions and

understanding the Land Safety Code.

Prepare to experience the wonders of the Whanganui Journey

at www.visitruapehu.com


UNREAL

LANDSCAPES

REAL

MOMENTS

STAY & PLAY IN RUAPEHU FOR YOUR NZ GREAT WALK

ADVENTURES

From adventure lodges, iconic hotels to alpine resorts, wake up with two NZ Great

walks at your doorstep and find your home away from home in Ruapehu.

VISITRUAPEHU.COM

Above: Despite the dull day, the reds and oranges of the surrounding tussock shone brightly

Right: Caitlin at the top of Taranaki Falls

TARANAKI FALLS

Words and images by Lynne Dickinson

I didn’t need to wait till sunrise to check the weather, I had

been listening to the rain fall on the roof all night, it was

just another wet one in the Central Plateau. It seemed to

have been the norm for this winter, not only in my neck of

the woods, but the rest of the country also seemed to be

suffering the same weather patterns.

One of the things I learned whilst on a multi-day hike in

Fiordland, is that not everything is better in sunshine.

Waterfalls, without a doubt, are so much better when

there has been plenty of rainfall. So, with that in mind, we

wrapped up warm and headed out to explore one of the

many day hikes leaving from Whakapapa Village.

The mountain was cloaked in mist and fog, and rain

seemed imminent as we set off toward Taranaki Falls.

The 6km circuit trail leaves from the road behind the

Chateau and can be completed in either direction. We

started at the Skotel and went in an anti-clockwise

direction.

The low light and the red tussock and manuka created

a real autumnal feel before merging with the Waihohonu

horse trail where layers of pumice and ash are still visible

from previous eruptions. The track crossed a series

gullies created by the wind, rain and frost action on the

volcanic soils, before dropping down to the Wairere

Stream. This section of the track was covered in red

tussock and although not clearly visible in the misty light,

we could hear the native birds nearby.

Walking in this direction means you enter the falls from

the top. We climbed as close to the edge as we felt safe

and looked down into the valley below and could see

our trail meandering down in the distance. There are

approximately 100 steps down to the base of the waterfall

and once at the bottom we realized what a great photo it

would be if someone was on the top of the falls. So, Caitlin

volunteered to run back up and around to the top of while I

stayed put to capture the moment.

In summer (or if you are a lot braver) you can walk

behind the falls and even swim in the river, but this was

the middle of winter, and although it’s been a fairly mild

one, we chose to just admire them from a distance. The

falls themselves, especially it the wet weather, were

impressive. According to DOC, the water tumbles 20

meters over the edge of a large andesite lava flow which

erupted from Mt Ruapehu 15,000 years ago.

Unfortunately by now, the rain had begun to fall so we

continued on along the lower track back which gave us

some shelter in the form of the forest consisting of beech

trees, umbrella ferns and mountain toatoa. We crossed

another stream, (fortunately all streams on the track

are bridged) and emerged into the tussock and alpine

shrubland typical of the Central Plateau region. On a

clear day you can see Mt Ruapehu, Ngauruhoe and Mt

Tongariro.

The track only took us 2 hours to complete, and the trail

was well formed and easy to walk throughout, however

Tongariro National Park is notoriously changeable and you

need to be prepared for all weather conditions. Make sure

you have all the correct clothing and equipment regardless

of how the day looks when you start.

TARANAKI FALLS

Length: 6km circuit

Time: 2 hrs

Start: Whakapapa

Village

Tips: Be prepared

for changeable

weather.

Leave someone at

the top of the falls

for a great photo

opportunity.



Top: Mick on his way to the Devils Staricase

Bottom L-R: We did it, at the Whakapapa I-Site / Next to Emerald Lakes / On top of Red Crater

THE NORTHERN CIRCUIT

IN THE SNOW...WITH THE KIDS!

Words and images by the De Zeeuw Family:

Dad Axel, Mum Lizzy, Mick (7yr old) and Tim (5yr old).

Doing the Tongariro Northern Circuit in the snow.

Why: We’ve been taking the boys on overnight/multi night

trips since January last year (2021). Before that we took

them out on daytrips in the weekend, first in the front/

backpack and later they had to walk themselves. We are

lucky that we live rurally and close to the Waikato River

Trails, so the boys have been doing 5km walks, sometimes

on a daily base, either in the pack, on their (balance) bike or

walking/running.

Last year spring we walked from Desert Rd Carpark to

Oturere Hut and climbed Red Crater from the scree side as

a day trip from Oturere Hut. There was snow and almost

nobody on the Crossing, but because we knew there was

no firewood at Mangatepopo Hut, we’ve decided to stay two

nights in Oturere Hut and walk out to Desert Rd the next

day. Since then, the boys wanted to complete the whole

circuit, Mick wanted to tick it off his list before he turned 8.

I’ve been wanting to this since we arrived in NZ 7 years ago,

but I couldn’t have dreamed doing this with both my boys at

this stage in their life.

Although we’ve been planning it for months, the forecast

looked good on those days that we had a week off, so that

was our gap to go.

When: September 2022

Where: Tongariro Northern Circuit, Tongariro National Park

I wouldn’t say this trip pushed the boys out of their comfort

zone, but it did show them that they are more resilient than

they think. They are both very aware of what was going to

happen and did some tricky tracks already. They know that

there is always the option that you must turn around and

can’t continue what you’ve started, but you always must try.

Mick pushed himself on the last day when he hurt his foot.

Although there were some tears, he pushed himself passed

that and kept walking. He’s a bit older and thinks more

about what effect his actions have, where Tim is always just

carefree and whistles even after a 16km morning.


Mick: Hello, my name is Mick de

Zeeuw, I am 7 years old and love

hiking. I live in Putaruru and am in year

3 at Te Waotu School. My teacher,

Mrs Topping, always gives me cool

tramping, mountain or nature books

to read. I also love to play soccer

and netball. The mountains I want to

climb are Mt. Everest, Mt. Cook, Mt.

Ngauruhoe and Mt. Ruapehu. When

I am older I want to do the Duke of Edinburgh’s Hillary Award.

My favourite hikes so far are the Tongariro Northern Circuit, Abel

Tasman Coastal track and the Taranaki Summit Route.

Why: I felt enthusiastic trying to do this, because last year we only

climbed Red Crater from Oturere Hut. I thought it would be fun, to

spend time away from home with my family and throw snowballs

in my dads face. I am keen to climb Mt. Everest when I’m older so

I have to start practicing.

What did you learn:

- Slow but steady wins the race

- Don’t give up, even when it gets hard

- If you want it, you can do it

What did you like the most: When I threw a snowball in dads

face and he tripped over, the snowball fight on the top of red

crater with an orc disguised as a guide.

Above: Downhill to Oturere Valley, the snow made the going down a lot easire than last year!

Left: Mick on the South Crater

Most challenging: When I hurt my foot, but I knew I had to keep

walking

Tips:

- Don’t eat yellow snow

- If you can, walk where other people walked so you don’t

sink hip deep in the snow

- Only go when the weather conditions are good and bring

a locator beacon

- Kids can do more than old people think

- Always bring lots of snacks! My favourite are snack

packs with nuts, raisins, cranberry, jellybeans and when

I’m lucky mum makes freeze balls.

- Pick up rubbish if you see it

- Don’t leave your rubbish at the hut but take it home

In my bag I always take: My sleeping bag + liner, my striped long

johns to sleep in, shorts, shirt, fleece jumper, first aid kit, down

jacket, rain gear, spare socks, crocs, a book to read at the hut/

campsite and playing cards, an emergency blanket, my snacks for

the whole trip, water, my compass and a whistle.

I really loved doing the Northern Circuit in winter, but I thought it

was more challenging than when I was climbing to the Taranaki

Summit in January. Next on my bucket list are Mt. Ruapehu

Summit, the Kepler Track, Stewart Island and the North/South

Track in the Kaimais.


Tim: (dictated to mum)

I am Tim and I am 5 years old. I

am in year 1 at Te Waotu School

and I did the Tongariro Northern

Circuit in the snow!

Biggest challenge: When it started snowing from Waihohonu to

Whakapapa, lucky I had my raingear on!

Coolest thing: Building a snowman with mum at Oturere Hut and

walking through the deep snow

Funniest: When mum got stuck in the deep snow and I threw a

snowball in her face.

Best part: Jumping down Red Crater in the deep snow and

playing Chess in the hut

Tips:

- Stay in other people’s footprints

- I might be small, but I can do a lot

- I need more snacks than an adult, I make lots of little

steps

Learned: Slow but steady wins the race

In my bag I always have snacks, water, spare clothes, my jacket,

my raingear, my pj’s, spare socks, my crocs, my sleeping bag and

liner (but sometimes mum or dad will carry it for me if we have a

long day) a book to read, emergency blanket, my compass and

my whistle.

Above: Tim stuck in the snow

Below: Tim climbing the last few meters to the top of Red Crater

Tips for parents:

- Bring plenty of snacks. Our boys have a bag with nuts, lollies

and dried fruit in their pocket/bag and they can grab something

whenever they want. In the beginning we would walk for a while,

and they had to wait till we sat down to eat but know they just

can eat something as we go. If that means they’ll eat a jellybean

at 8:05AM, 5 minutes after you started, so be it. If they’re happy,

you have a fun trip!

- Plenty of layers. Our children are never cold, but they wore a

lot of layers. It’s always easier to take a layer off than to have a

cold, grumpy child.

- Raingear. Although it was sunny, the boys both wore their rain

pants and jacket, with gaiters, a fleece jumper, long johns and

shorts. Their down jacket was too hot, the raingear protected

them from the cold, and they didn’t get wet after falling/playing in

the snow!

- Try to find out if the hut has firewood! After being in the snow

all day, it’s nice that socks/shoes/clothes can dry so they don’t

have to put their wet gear back on the following morning.

- Make sure they know where they sign up for. It’s a challenging

track, even for some adults, although my children show me

every time that they are more versatile than we think.

- Know their limits! Be aware that your children can do a day

of the track in a certain amount of time and don’t make it into

10hour days. That way they can enjoy some downtime at the

next hut and you’re not stressing about getting to the hut before

dark. Stressed parents and grumpy children are not a good

combination. Our longest day was just under 5 ½ hour from

Waihohonu to Whakapapa and it could’ve been faster if Mick

didn’t hurt himself. On the other hand, don’t think they can’t do

it. Most times, our children surprise us in what they can do, but

better try to find out on an easier track and not in the snow.

- Don’t let other people tell you, your children can’t do it.

Especially those children that have been out and about for years

can do more than the average adult.

- Always bring enough supplies, so if you’re stuck an extra day,

you have enough food to keep your children and yourself warm

and fed. Low weight backpacks will come again once they’re old

enough to take half of your gear.

- Most of all, enjoy! We are lucky to have this amazing scenery

on our doorstep and to share this with our children is definitely a

privilege!

- Both boys always carried a laminated paper in their backpack

with their name, date of birth, address, phone number and

emergency contact number, in case of emergency.


southernapproachnz

Come cycling in stunning

Central Otago and let the

experts look after all your needs

> Lake Dunstan Trail

> Otago Central Rail Trail

> Roxbourgh Gorge Trail

and more...

Because it is all about you

Trail riding Central Otago

Call the experts at Bike It Now!: 0800 245 366

Clyde Bike Shop and Tour office open 7 Days

Cromwell Bike Shop open Monday - Saturday

NEW SHOP NOW OPEN IN WANAKA open 7 days

www.bikeitnow.co.nz

2022

THE GROWTH OF

AN ICONIC KIWI

BUSINESS Reflection by Kathryn Fletcher

Lisa, Duncan and Fletch

It is nine years this month (September

2022) since we, Lisa Joyce, Duncan

Randall and Kathryn Fletcher (Fletch),

opened Bike It Now!, offering bike retail,

bike hire and bike tours in Clyde.

It all began with Lisa and I walking our

dogs along the back lane of Clyde in

September 2012. Dunc was outside a

small bike hire shop and travel agency

called Bike It Now! washing rental bikes.

Duncan had just moved with his family to

Clyde from Dunedin, like Lisa and I had

just done after Lisa secured a job working

for Contact at the Clyde Dam, so we had

that in common from the outset.

Our business connection began on August

23, 2013, with the three of us purchasing

the business from the late and great Ross

McRobie and his wife Petrea; they had two

full-time staff, one of them being Duncan.

When we reopened in September, three

weeks later, we had expanded into retail

and added a workshop as we needed to

create a business that would be able to

look after us all.

Things have changed in the cycling

industry significantly since 2013, and we

have been fortunate to be at the forefront

of this, namely the shift away from 26'

bikes to 27.5' and 29' along with the rise of

E-bikes. We had the first E-Bike for hire, a

Scott E Aspect, out on the Otago Central

Rail trail in 2014; all E-bike riders had to

have a medical reason for riding an E-bike,

as the rules prevented E-Bikes from being

used on DOC managed trails.

DOC's stand changed very quickly, so

by 2015 we had a fleet of E-bikes which

proved popular. We also started to retail

E-bikes at the end of 2014. While this

was going on, John Key was making his

mark on the Cycle tourism industry in NZ

by allocating significant funding to Trail

development, particularly for Great Rides.

Central Otago benefitted through the

Roxburgh Gorge Trail and Clutha Gold

Trail development's initially - remembering

the Otago Central Rail Trail had been

opened in 2000 but was separate from this

funding model.

Roll forward to 2019 when the Lake

Dunstan Trail was started, part of a

unique project; riding from Queenstown

or Wanaka to Dunedin via a trail network

and not having to ride on roads. This is

ongoing, but the Lake Dunstan Trail from

Cromwell to Clyde was opened on May

8 2021. The other linking sections are all

happening over the next few years.

COVID, to the bike industry and Central

Otago in particular, created a very ‘busy

time’, a silver lining, with NZers not

travelling overseas and looking for options

at home. The significant spending on

E-Bikes and then looking for places to

take them for 1/2 day to 9-day rides has

impacted all cycle-based businesses in our

small area. The flow on to accommodation

and hospitality providers has been very

positive as a result.

Relationships have always been essential

to us throughout this time, from our

suppliers of bikes to our accommodation

providers and, most notably, our staff.

Bike It Now! is all about looking after staff,

customers and our community.

Loyalty has always been the backbone to

our business; to our staff, our customers

and our suppliers/reps. I feel I need to

mention mention four people in particular,

Jan who has been creating tours for our

customers for nearly nine years and 3 of

our supplier reps; Ben Vial and Shakey,

who have been with us from the beginning

and are still with us, also Rowan Miller,

who is no longer in the industry but had a

significant impact on all of us.

We have also had a great relationship with

Webstudio in Queenstown and Buchan

Design in Roxburgh since day one, they

always have us covered.

We have always tried to support our local

community and make positive impacts,

whether it be sponsorship or just being

good citizens. We have worked with

Regional Tourism and Tourism NZ and

promoted Central Otago first and foremost

as the place to visit both domestically

and for our international visitors and the

business has expanded to include stores

in both Cromwell and Wanaka.

3

Full-time staff

September

2013

23

Full-time staff

September

2022

2013

Significant moments:

Sept 2013: opened Clyde shop,

retail, hire, workshop and tours.

2016 onwards: Trip Advisor

Excellence Awards, Hall of

Fame 2019 and travellers'

choice 2020, 2021 and 2022.

Nov 2018: gained Qualmark

Gold award, the first self-guided

cycle tour company in New

Zealand to achieve this, and we

have retained this in all reviews.

July 2019: opened Cromwell

Bike shop, with retail, workshop

and hire.

July 2022: opened in Wanaka,

with retail, workshop and hire.


CAMPING

&

TRAMPING


hydro flask 621ml, 710mL & 946mL Trail Series $69.99-$89.99

WWW.HYDROFLASK.CO.NZ

Klymit Insulated Static V $229.95

WWW.OUTFITTERS.NET.NZ

kiwi camping ruru 4 hiker tent $439.00

WWW.KIWICAMPING.CO.NZ

tasty chicken mash $9.99 - $14.99

WWW.BACKCOUNTRYCUISINE.CO.NZ

black diamond Trail Pro Trek Pole $239.99

WWW.SOUTHERNAPPROACH.CO.NZ

RAB Alpine 600 Sleeping Bag $$699.95 - $759.95


Lowe alpine Sirac 65L/ND65 $349.95


SALEWA ALP TRAINER 2 MID GTX $429.90

WWW.BOBO.CO.NZ/SALEWA


cotopaxi 16L & 24L Batac Backpack - Del Día $159.99-169.99

A stowable daypack that deploys for fast-and-light daytrips,

hikes, and other micro adventures. Made with 100%

repurposed fabric, making each bag is one-of-a-kind.

WWW.COTOPAXI.CO.NZ/COLLECTIONS/DEL-DIA


Great for weekend or shorter trips

and featuring the adjustable Air

Contour X carry system, hip belt/

front/side pockets, sleeping bag

compartment, rain cover, pole

attachments and lash points.


osprey Sportlite 25 $199.99

Confidently step out on the trail with the Sportlite

25, one of our most minimalist technical day packs.

Carry all of your essentials with the convenience

of panel-loading design and simple, clean internal

organization. An AirScape® backpanel and

suspension system moves with you dynamically

and keeps your carry stable and ventilated. Made

with 100% recycled materials. Two size unisex fit.

• Trekking pole loops w/ upper compression strap

capture

• Stretch side water bottle pockets

• Padded hipbelt with one zippered pocket and one

open stretch mesh pocket

Find a Stockist: WWW.SOUTHERNAPPROACH.CO.NZ


The Sirac 65 is a reliable, lightweight,

loaded with features pack with a

strong and stable carry making it

ideal for long backpacking and selfsufficient

treks.


Lowe alpine AirZone Trail 35 $299.95

The AirZone Trail 35 features an AirZone carry system,

single buckle entry, compression straps, rain cover, pole

attachments, ice axe loop, front/side pockets and is

hydration compatible.



FEATURED PRODUCT...

equip

yourself!

Rab Aeon LT 25 Pack $199.95

The Aeon LT 25 is the largest Aeon LT pack, offering generous volume to carry all your

gear in wild, mountain terrain. Featuring a responsive and flexible Air Contour back

system keeping the air flowing, double strap harness and moulded back panel provide

a comfortable, secure, bounce-free carry, on-harness walking pole attachments, stretch

bottle pocket, large side stash pocket, front stash pockets, side compression straps,

hydration compatible with space for a 3L bladder, zipped harness pockets and robust

70D construction made with 50% recycled nylon making it ideal for fast-paced, committed

ascents, ultralight bivi’s and hut nights.


Low Prices Everyday

Black diamond Trail Pro Trek Pole $239.99

With a huge range of adjustment and a wellbalanced,

durable design, the Trail Pro is a

reliable, high-performance pole for day hikes or

in the mountains.

• SmashLock quick Release technology for

quick deployment and collapsibility

• New FlickLock Pro adjustability—now

featuring aluminum construction that’s lighter

and easier to use

• Updated soft-foam grip with solution strap for

added security and better handling

• Interchangeable carbide Tech Tips, 38mm

Trekking Basket

• Ski compatible ferrule will accept 100mm

powder baskets for deep snow

• Available in Men’s and Women’s design

Find a Stockist:


Free NZ Shipping on

orders over $150 for

members

Members Earn Equip+

Loyalty Points

shop online or instore

equipoutdoors.co.nz

62 Killarney Road,

Frankton, Hamilton,

New Zealand

P: 0800 22 67 68

E: [email protected]

GLERUPS HONEY RUBBER AND BLACK RUBBER SHOE $189.00

When you are camping, you need a shoe that is good on

all surfaces including inside the tent or the hut.

Made from 100% natural wool, glerups provides an

instant comfy at home feeling. They are light, versatile,

and well worth the space in your backpack.

Get natural, get cosy and get yourself some glerups.

WWW.GLERUPS.CO.NZ

SALEWA ORTLES ASCENT MID GORE-TEX® $749.90

The Ortles Ascent Mid Gore-Tex® is a solid solution for alpine

mountaineers. Its thick suede leather upper, SALEWA® 3F System with

steel cables and reinforced TPU rand make it exceptionally robust and

durable, while the stiff carbon-loaded nylon fibreglass insole increases

stability during activity. It has been engineered with a dual density

expanded polyurethane midsole with dedicated stiff and cushioned zones,

to ensure both comfort and precision, while the interchangeable layers of

the Multi Fit Footbed Plus (MFF+) allow a customizable fit.

Fit: WIDE Weight: (M) 850 g


SALEWA WILDFIRE 2 $329.90

Engineered for technical terrain, the Wildfire 2 is a lightweight, agile and

precise tech approach shoe with a breathable recycled synthetic mesh

upper, and a 360° protective rand. It’s equipped with climbing lacing for

fine adjustment in the toe-area and a lateral net system with Kevlar®

cables for better overall performance and sensitivity. The POMOCA®

outsole with Butylic compound rubber is designed for precision and

sensitivity in mixed mountain terrain and ensures good grip on rock in both

dry and wet conditions.

Fit: STANDARD / Weight: (M) 355 g (W) 305 g (pictured)


SALEWA ALP TRAINER 2 MID GTX $429.90

The Alp Trainer 2 Mid GTX has a suede leather and stretch fabric upper

with a protective rubber rand. Featuring a GORE-TEX® Extended Comfort

lining for optimal waterproofing and breathability, and customizable Multi

Fit Footbed (MFF) with interchangeable layers allows you to adapt it to

the unique shape of your foot; Climbing Lacing right to the toe allows for a

more precise fit, while the Vibram® Hike Approach outsole covers a wide

spectrum of mountain terrain.

Fit: STANDARD / Weight (M) 552 g (W) 482 g (pictured)


SALEWA WILDFIRE CANVAS $279.90

The breathable recycled cotton and hemp canvas upper is protected

by a full 360° TPU rand. Our 3F system with nylon-coated Kevlar®

cables provides additional support and greater stability at the heel, while

ensuring a precise fit. The dual density eco Ortholite® footbed promotes

superior cushioning, and the Pomoca outsole offers secure grip during

light hiking approach activities.

Fit: STANDARD / Weight: (M) 305 g (W) 256 g (pictured)



exped Mira II HL Tent $749.99

2-person, lightweight, 2-door, 3-season tent with a

free-standing canopy design. A ridge pole increases

the space inside for comfortable sitting, large finemesh

panels. Poles, sleeves and fasteners are

colour coded for fast pitching and it comes with a

2-section stuff sack. Packaged weight 1.5kg

WWW.BIVOUAC.CO.NZ

exped Outer Space II Tent $899.99

3-season tent which can be set up in multiple modes.

Features a giant, pole-supported front vestibule that

easily shelters 3 people in camp chairs, a lightweight

table and backpacks. The poles are on the outside of

the fly and allow you to pitch the inner and outer tent

in one go or pitch the fly only without the inner tent.

Packaged weight 2.9kg

WWW.BIVOUAC.CO.NZ

kiwi camping weka 2 hiker tent $339.00

Spacious two-person tent with

vestibule and double entrances. Fits

in a backpack, ideal for all year-round

hiking. 4000mm aqua rated fly with

SPF50 UV coating. 3-year warranty.


Kiwi Camping Weka 3 Hiker Tent $379.00

Spacious three-person tent with

vestibule and double entrances. Fits

in a backpack, ideal for all year-round

hiking. 4000mm aqua rated fly with

SPF50 UV coating. 3-year warranty.


kiwi camping ruru 4 hiker tent $439.00

The Ruru is a lightweight and easy-pitching hiking tent

with a semi-geodesic alloy frame. Breaks down into

three separate bags for lightweight hiking.



Jetboil mini mo $329.95

It's about cooking. MiniMo delivers

UNMATCHED simmer control, metal

handles, and a low spoon angle for easy

eating! Starting with the innovative new

valve design, MiniMo delivers the finest

simmer control of any upright canister system

on the market. Thanks to our proprietary

regulator technology and enhanced

regulator diaphragm, MiniMo ensures this

consistent performance down to 20ºF (-6ºC).

Its redesigned cooking cup, the perfect

combination of size, sturdy metal handles,

and optimized height, provides users with an

easy-to-eat experience.

WWW.JETBOILNZ.CO.NZ

Klymit Ridgeline Camp Chair High Back

$229.95

The lightweight Ridgeline High

Back Chair features a padded

headrest, an engineered 16’ 5”

high seat and vented mesh panels,

it is perfect for relaxing in.


kiwi camping boost lED light $89.99

Bright LED light with power bank to

illuminate your tent and charge devices

on the go. Features 11 light modes

including SOS signal, built-in magnets

and hanging hook.


sea to summit Camp Kitchen Tool Kit 10 Piece $69.99

Hang this compact kit in your camp kitchen and you'll

have most things you need on hand to create - and

clean up after - gourmet outdoor meals. The kit

contains everything from empty leakproof bottles for

oils and condiments, to a folding spatula and serving

spoon, to a pot scrubber, washcloth and dishcloth.

Find a Stockist: WWW.SOUTHERNAPPROACH.CO.NZ

Jetboil Flash 2.0 $249.95

BOIL IN SECONDS, NOT

MINUTES Blistering boil times

come standard on our industryleading

Flash. By modelling

the combustion and selecting

materials to optimize efficiency,

we were able to create the

fastest Jetboil ever — cutting a

full minute off our best boil time.

WWW.JETBOILNZ.CO.NZ

Chair Zero High-back $299.99

With a taller back for added support and

comfort, the Chair Zero High-back has the

same DNA as Chair Zero, an ultralight,

compact, go-anywhere chair. The Chair Zero

High-Back is a good choice for activities

where weight saving is top of mind, such as

backpacking, kayak tours, moto-touring or

bikepacking.


58//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#233

Jetboil stash $299.95

The Lightest and Most Compact

Jetboil Ever. We know your

dreams are big and ambitious.

Which is why we designed the

all-new Stash to be lightweight

and compact, maximizing your

pack space without sacrificing

that iconic Jetboil performance.

At 7.1 oz or 200 g, the .8L Stash

is 40% lighter than the .8L Zip.

WWW.JETBOILNZ.CO.NZ

hydro flask 621ml, 710mL & 946mL Trail Series $69.99-$89.99

Ridiculously light, and durable enough for any trail, our Trail

Series collection is 25% lighter than our other flasks thanks

to an innovative stainless-steel design.

WWW.HYDROFLASK.CO.NZ

The highest level of

performance and

protection meets

sustainability.

The

lightest

system

in its

category

STASH

FEATURE HEAVY

PACKS LIGHT

SO LIGHT YOU MAY

FORGET YOU’RE EVEN

CARRYING IT

WEIGHT

200g

VOLUME

0.8 Liter

POWER

4,500 BTU/h

(1.52 kW)

BOIL TIME

2 minutes

30 sec. per 500ml

www.jetboilnz.co.nz

PreCip® Eco Jacket

marmotnz.co.nz

Learn more about our

sustainability efforts

exped DURA 6R Sleeping Mat (medium) $359.99

Durable, supportive mat insulated with

responsibly-sourced down insulation

for comfort on demanding adventures

in cold conditions, including extended

alpine outings. Recycled 75D/170D

brushed polyester fabric and 7cmthick

chambers with fatter chambers

at the sides to reduce the chance of

rolling off. Certified carbon neutral by

myclimate.

183cm x 52cm. 5.8 R-value. 885g

WWW.BIVOUAC.CO.NZ

exped ULTRA 3R Sleeping Mat (medium) $279.99

Lightweight, packable mat with light insulation

featuring recycled 20D ripstop face fabric, 60gm/2

Texpedloft microfibre insulation and 7cm-thick

chambers with fatter chambers at the sides to

reduce the chance of rolling off. Certified

carbon neutral by myclimate.

183cm x 52cm. 2.9 R-value. 465g

WWW.BIVOUAC.CO.NZ

Rab Alpine 600 Sleeping Bag $699.95 - $759.95

A mid-weight, 650FP three season,

duck down bag with a tough and wind

resistant Pertex® Quantam outer

with recycled nylon lining designed to

maximise warmth.


Rumpl NANOLOFT® TRAVEL BLANKET $179.99

This travel sized blanket is perfect for

every adventure - take one with you

wherever you go, from the alpine hut to the

airport.

WWW.RUMPL.CO.NZ

Kiwi Camping Mamaku camper Sleeping Bag

$94.99

The Mamaku Camper is great for hiking

and camping, weighing 1.1kg. The

compression bag allows for easy pack

down while the silver thermal lining

keeps you toasty warm on adventures.


Klymit Insulated Static V $229.95

The Insulated Static V packs light and small, has a

4.4 R-value, body-mapped shape and V chamber

design for comfort, lofty Klymalite insulation, and

side rails.


kiwi camping Rover Lite 3cm Self-Inflating Mat

$109.00

Compact to pack and carry, the Rover

Lite self-inflates in minutes. The tapered

design can fit in a sleeping bag, 1830mm

long and 550mm wide.



New Zealand’s best

and biggest online store

solely dedicated to Non

Alcoholic adult drinks.

Perfect after a days adventuring - satisfy the taste without

the after effects. Adult drinks that make you feel part of the

socialising yet let you wake up the next day with a clear

head ready for your next adventure.

.

No matter your reason.......we’ve got you covered

Beers - Wines - Spirits - RTD’s - Ciders - All delivered to your door.

www.clearheaddrinks.co.nz

SOBER OCTOBER

Visit the team at Clear Head Drinks for 20% storewide

discount to celebrate Sober October.

WWW.CLEARHEADDRINKS.CO.NZ

ONE FOR THE ROAD - proceed with caution

amber ale $7.95

This all season medium-bodied

lager showcases both malt and

hops. It follows with a toasty malt

character with only a subtle hop

bitterness.

Warthog Classic II Elite Sharpener $199.00

3 Adjustable Angles(20,25 & 30), 325

Grit Natural Diamond Rods, Metal Frame

Construction, Durable Powdercoat Finish,

Finishing Steels.

WWW.KNIFESHARPNERS.NZ

KEA STASH $59.99 - $89.99

The Trash Compacting Bag

for Mess Free Adventures.

100% leak-free, smell-free

and reusable. Fill It - Crush

It - Stash It

WWW.KEAOUTDOORS.COM

BACK COUNTRY CUISINE:

The first thing you’ll notice is that the front label on their pouches

have changed for the better by adding Health Star Ratings and

energy, protein, fat and carbs per pouch. They have also improved

the readability of our back labels.Back Country Cuisine is available at

leading retailers. For more information or to find your nearest stockist

visit: www.backcountrycuisine.co.nz

local dehy hummus $8.00

Roasted Red Pepper &

Sundried Tomato, also

available in Beetroot and

Zesty Lemon. Perfect

for lunches on the trail.

Dehydrated. Vegan. Home

compostable packaging.

WWW.LOCALDEHY.CO.NZ

tasty chicken mash $9.99 - $14.99

With smoky flavoured freeze dried

chicken, cheese and vegetables.

3.5 Health Stars - Gluten Free

Available small serve (90g) or

regular (175g)


Apple & Berry Crumble $13.99

A sweet mix of freeze dried apples

and berries topped with a delicious

gluten free cookie crumb.

3 Health Stars - Gluten Free


INSTANT PASTA $4.99

Just add boiling water for perfectly

cooked pasta.

3.5 Health Stars

Sizes – Family 120g


local dehy kumAra chickpea curry

$17.50

Mildly spiced Indian curry

with spinach & brown rice.

Refuel after a day's adventure!

Dehydrated. Vegan. Home

compostable packaging.

WWW.LOCALDEHY.CO.NZ

rescueme PLB1 $589.98

Wherever you are, at sea, on land,

the rescueME PLB1 provides the

reassurance that global emergency

services can be alerted by the press of

a button.

The rescueMe PLB1 can be operated

with a single hand in even the most

challenging situations. A simple springloaded

flap covers the activation button

preventing inadvertent use. rescueME

PLB1 works with the only officially

recognised worldwide dedicated search

and rescue satellite network (operated

by Cospas Sarsat). As this is funded by

governments there are NO CHARGES

to use this service.

Available through all leading sports and

recreation retailers and online.

WWW.RESCUEME.CO.NZ

sunsaver classic 16,000 mah

solar power bank $119.00

Built tough for the outdoors

and with a massive battery

capacity you can keep all

your devices charged no

matter where your adventure

takes you.

WWW.SUNSAVER.CO.NZ


PROVEN

TO SAVE LIVES

30% (typ) smaller 7 year battery life

66 channel GPS

– Fast accurate positioning

EPIRB1

Essential

for safe

boating

The World’s Most

Compact Emergency

Position Indicating

Radio Beacon

PLB1

Personal

Locator

Beacon

The World’s

smallest PLB

Patagonia Tee-Cycle T-shirt $89.99

All Shirt, no dirt! Patagonia's new Tee-Cycle T-shirts

are part of a circular system, so there's no need

to grow anything new. Made from discarded tees

destined for landfill, they help solve the textile waste

problem and are part of Patagonia's goal to create a

closed-loop process for clothing. Soft and comfortable,

they feature screen-print inks that are PVC – and

phthalate – free, plus are Fair Trade Certified sewn.

WWW.PATAGONIA.CO.NZ

Chickfly Bamboo Leggings High Rise

or Low Rise (USD $119.00)

Chickfly leggings are made

with soft, strong, stretchy

and sustainable bamboo

fabric, coloured with organic

dyes. Our patented fly is held

together by tension, creating

a seamless, flattering, soft,

and easy-to-use feature in the

most comfortable and stylish

black legging that every

woman needs not only for

style but for convenience and

functionality.

WWW.CHICKFLY.COM

rab Filament Pull-on $169.95

Embrace extreme sport with

comfort and confidence. At

213g, the Filament Pull-on is

a lightweight stretch fleece

mid-layer that fully warrants its

place on any high-energy trip.


30% (typ) smaller 10 year battery life

LAB0684

5 year warranty 406-link via

satellite to

Emergency Services

www.rescueme.co.nz

Macpac 220 Merino Long Sleeve Top $119.99

A staple for any adventurer, made from

midweight merino wool for natural warmth,

temperature regulation, and odour

resistance.

WWW.MACPAC.CO.NZ

Zerofit Heatrub Ultimate Baselayer (A$129.95)

Independently tested at the Boken Institute in

Osaka, the Ultimate has proven to be five times

warmer than leading competitors, using ‘Heat

Threads’ inside the garment to generate warmth

instantly.

WWW.ZEROFIT.COM.AU

cotopaxi Abrazo Hooded Fleece Jacket $229.99

A cosy jacket that embodies our commitments to

sustainability, the Abrazo is made with recycled fabric

which puts a thoughtful spin on the classic fleece.

WWW.COTOPAXI.CO.NZ

marmot PreCip® Eco Pro Jacket $299.95

Meet the newest addition to our high-performing PreCip

line: the PreCip® Eco Pro Jacket. Waterproof Marmot

MemBrain® and 100% seam taping for zero leaks blocks

the rain as you hike, paddle, or play. The PFC-free coating

keeps you dry while the hood and drawcord hem provide

for extra comfort and coverage. Open up the heat releasing

PitZips when the pace picks up and stash extra gear in the

large pack pockets.

• 20k/20k Marmot MemBrain® lamination with 2-layer

waterproof/breathable fabric repels water and reduces

internal condensation

• PFC-free water-repellent coating keeps you dry and

minimizes environmental pollution; 100% seam taped to

keep water out

• Attached hood with peripheral cord adjustment for extra

coverage

• PitZips provide ventilation to regulate body temperature

• Large pack pockets under a welt for protection

• Zipper with storm flap and adjustable drawcord hem to

block drafts

WWW.MARMOTNZ.CO.NZ

Patagonia Microdini 1/2-Zip Pullover $209.99

Combining two of our favourite materials, Micro D and Houdini,

Patagonia created a lightweight fleece that provides everyday

warmth and comfort. This 1/2-zip fleece pullover with warm standup

collar, features an exterior trimmed in recycled nylon for added

wind protection. Available in cuts for adults and kids, it's Fair Trade

Certified sewn, which means the people who made it earned a

premium for their labour.

WWW.PATAGONIA.CO.NZ

cotopaxi Fuego Down Vest $299.99

Blending responsibly sourced,

water-resistant down with

a streamlined design - our

Fuego Vest is the perfect

spring layer for all adventures

near and far.

WWW.COTOPAXI.CO.NZ

Outdoor Research Vigor Plus Fleece Hoody $249.99

Low-bulk, lightweight, water and wind resistant,

providing comfort, warmth and versatility on

your cold-weather adventures. It is made with a

93%-recycled polyester engineered for amazing

stretch and mobility that has a highly-breathable

high-loft grid interior for active warmth and moisture

wicking on stop-go activities. Other features include

an overlay on the chest for added wind resistance

and pockets to stow small necessities.

WWW.BIVOUAC.CO.NZ


Zerofit: A personal preference

When a company makes a claim that

its thermal wear product is five times

warmer than the traditional base layer,

that is a big claim.

When Zerofit arrived on the courier,

the very first thing that came to mind

was the weight. Thermal wear that

claims to be five times warmer than

anything else you would expect to

be heavy - it wasn’t. I went through

and read in detail how Zerofit was

supposed to work.

How it works: The Heat Rub uses

“double-loop” barrel fabric to provide

both heat insulation and “friction

heating”. The extra-long bristles

ensure a layer of warm air, and even

a little movement of these bristles

causes friction, which creates heat

which in turn warms you up.

It is stated, “The Heat Rub is twice as

warm as a jumper and is comparable

to a coat but with the ability of ease

of movement for active sports and

working”.

The concept sounds like it would work, but it didn’t

sound very comfortable. Personally, I struggle

with any sort of base layer that has even a merino

component. My partner refers to it as ‘girly skin’,

not very PC. I like to feel it's simply sensitive. So,

the concept of ‘heat rub’ sounded like it was not

going to be for me, but I was wrong.

During the winter months, we move to the Central

Plateau to ski, trout fish, and tramp. I started

using the Zerofit when fishing, it’s light and very

maneuverable. From the moment you put it on, it

is comfortable, which for me personally is a game

changer. I found it super warm and didn’t need

any additional layers; plus it was not bulky at all.

This year the skiing has been limited but those

days we have had on the mountain have been

chilly 2 and 3 degrees, plus often with a severe

wind chill. Once again, the Zerofit kept me warm

and comfortable without the additional weight, I

wore just my Zerofit and a ski shell jacket.

Lastly, we have done several tramps around the

Ruapehu region which are as you would expect in

winter is cold. 50% of the time I needed to remove

my Zerofit because I was simply getting too warm

(better to be too warm than too cold) pulling off the

Zerofit and stashing it in a backpack was easy, it

crushes up small and is super lightweight. If I had

one suggestion for Zerofit it would be to add in

thumb loops.

It’s not often a new product comes on the market

and lives up to the hype Zerofit has delivered all is

promised and more.

For more info visit: www.zerofit.com.au


You don’t need it, but

you sure will want it -

high quality gear for serious adventures.

www.lightandfast.co.nz

EXPANDING

HORIZONS

EXPLORING WITH

A ROD IN HAND

Words and images by Matt Butler

New Zealand is a place of expansive wonder shaped by

weather and water. Huge rugged peaks give way to cascading

cliffs, with sweeping valleys in which rivers are born and then

flow to feed the vast Pacific Ocean. These rivers form not only

our land, but are also the guiding pathways for our roads and

tracks to follow.

Almost every hiking track in NZ follows a river or stream for

at least some, if not all of their journey. They weave up the

valleys, follow the banks and occasionally pass over with the

help of a rickety swing bridge.

The river is often seen as just an accomplice to the hike,

sometimes nice to look at, swim or drink from but little else.

But what would you think if I told you the water could become

your chief inspiration for adventure? Something that can take

you deep into places you never even realized or imagined you

could go. Places where you are unlikely to see another soul

and where you never have to sleep near a stranger. These are

the places we explore with a Fly Fishing rod in hand, forever

pushing forward not to the end, but just to see what is around

the next bend.

How fly fishing opened me up to the world…

I fell in love with the sport of fly fishing at a young age, not

only because I had a burning desire to fish, but also because

it gave me a motive to explore new places, some of which I

never expected to find. The pursuit of trout was all that was

required to get me out there and more often than not it resulted

in nothing more than a walk beside the river. Regardless of the

outcome, every time I learnt something new, stoking the desire

to go further in search of new water, new landscapes and new

experiences.

Fly fishing is all too often thought of as an old guy standing

in the river for hours on end, flicking back and forth his line,

without so much as a few footsteps. This may have been

common in days gone by but the sport is now growing into an

lauded adventure activity. It’s now common to push the limits of

how far you can go into the wilderness and even something in

which you would choose to travel across the world to pursue.

My love for fly fishing quickly developed into an obsession, as

I spent every available moment exploring the valleys of the

Waikato and Bay Of Plenty. From twisting spring creeks of the

South Waikato, through to thunderous gorges of the Central

Plateau and everything in between. Fly Fishing allowed me

to understand the twists and turns of the region like the back

of my hand. It made me eager to start exploring further and

challenge myself against the best, so it wasn't long until I made

my move to chase trout in the South Island and eventually

around the world.


I fell in love with the sport of fly fishing at a young age, not only because I had a burning desire to fish, but also

because it gave me a motive to explore new places, some of which I never expected to find.


Above L-R: The diversity of NZ’s landscape is clearly seen when your hunting trout / The fish are often as beautiful as the scenery

Fly fishing can take you to the wildest of places like the depths of Fiordland / Right: Netting a solid trout on a thunderous high country river

At 24 years old I moved to Wanaka to indulge in the spectacular

waters of the Southern Alps. This quickly morphed into wanting

to be out there every day, so I took the leap and became a

Fly Fishing guide. Not only did this allow me to explore further

and deeper into New Zealand than I ever dreamed possible, it

also provided me opportunities to spend my winters fishing in

far flung corners of the world, from Iceland to Japan and many

places in between.

I was never an overly eager tramper, camper or anything of the

sort. Although I loved being out in the wild, I always needed a

reason to be there, rather than just making it to the ‘end’ or to

the ‘top’. It was the river and fly fishing that opened up New

Zealand to me. I now had a reason, a goal for walking three

days into a backcountry valley I had never seen before. Or

even to the otherside of the world into the Alligator infested

everglades to chase Tarpon. It was not the species of fish that

mattered, it was the pursuit of a fish on the fly that gave me

motivation.

---------------

Hiking (or Tramping) in New Zealand is as old as the first

settlers. It was common for local Māori to hike across the

passes from Queenstown to Wanaka for food gathering and for

European explorers to go on a wild goose chase in search of

gold. One thing they all had in common was their single minded

purpose and having a distinct motivation to push further.

These days a hiker's motivation can range from making it to the

next hut, conquering a mountain or completing a great walk and

many other adventures. Although there is nothing wrong with

this, there is still one thing all have in common, they follow a

predetermined path to a set destination. The thing I love most

about fly fishing is a sense of the unknown, the true adventure

of it all. How will you access the water, will you need to cross

the river or climb over a gorge? Can you even get around the

next bend without some goat-like traverses? Is it worth pushing

forward or is it time we should turn back? These questions keep

me exploring.

The variety and abundance of waterways in New Zealand is mindboggling.

From one place to another can often feel like you are

in a different country, as the bush lined green water is replaced

by the crystal blue water in wide open river valleys. Many of

these places have no defined track or trail, requiring instead a

doggedness to venture and figure it out as you go. Just like in my

younger days, these trips often result in nothing more than a nice

walk. But still that feeling of going somewhere you never have

before can fire up more energy than a shot of caffeine.

Fly Fishing in these waters is unlike anywhere else on the

planet, you slowly stalk streamside, eyes fixed on the water in

the hope of seeing a conspicuous shape swaying in the current.

Most of the time you do not see anything, you keep moving,

sometimes covering a serious amount of ground in a day

without even realizing it. Then you find your target, it becomes

a tense battle of cat and mouse as you try to persuade a fish

that your offering is worthy of eating, and if it is then it becomes

full blown hand-to-hand combat. If you're lucky enough to get

a fish successfully in the net, then the best experience of all

is carefully removing the hook and releasing it back into the

water to fight another day. There is little else that can offer such

a fulfilling feeling of accomplishment and appreciation for the

land, animals and water surrounding you.

The sport of Fly Fishing is actually more akin to the feel of

hunting than it’s namesake ‘fishing’. It feels this way as you are

always on the prowl in search for your next target, only stopping

when necessary. You will find yourself scouring over topo maps

in search of that next river to explore. Heading deep into the

backcountry, staying in DOC huts or camping under the stars,

walking for miles into the untouched wilderness. That is what

Fly Fishing in NZ is all about.

---------------

The first step to starting on this new journey is to learn the ins

and outs of the sport. Fly Fishing requires a unique set of skills

that although can take some time to master, they are not hard

to learn. It is not unusual for an angler to spend their whole life

learning the intricacies of a certain species, their behavior and

how best to target them. Luckily in NZ we have an abundance

of both Rainbow & Brown Trout in almost every river and lake.

This means that no matter where you are in the country, it’s

likely you will have a place nearby to start practicing.

Getting started in is not as costly or complicated as you may

have been led to believe, all you need is a few basic things to

get started.With many affordable options on the market these

days, this full setup can be assembled on any budget:

1. Rod, Reel, Line - whatever you can afford is fine;

2. Basic selection of flies - nymphs and dries;

3. Polarized sunglasses; and

4. Fishing Net.

The gear you buy does not define the type of angler you are,

practice is key. So once you are set up, then it’s just about

getting out there, practicing your casting and learning how to

read water. Start in the backyard then head out to explore your

local waterways, access points can easily be found on the Fish

& Game website.

By taking on the pursuit of fly fishing, the country and all its

beauty will open up to you as you explore the far corners in

search of trout. Should you become a lifelong addict like many

anglers are, you will be amazed at just how fulfilling both the

sport and the experience can be, allowing you to explore,

connect and grow.

So as a keen angler says - Enjoy it out there and ‘tight lines!’

If you’re interested in learning more about Fly Fishing and gain

some tips, tricks and advice about how to start and progress

through the angling journey. This is all available on my ‘Live

Wild Journal’ at: www.keaoutdoors.com



FEED YOUR ADDICTION

Like a ‘perfect storm’, we have seen a dramatic growth and

development in online stores over the past 5 years.

We are dedicating these pages to our client’s online stores; some

you will be able to buy from, some you will be able drool over. Buy,

compare, research and prepare, these online stores are a great way to

feed your adventure addiction.

Never have a dead phone

again! Because now you can

charge straight from the Sun

with SunSaver. Perfect for

that week-long hike, day at

the beach, or back-up for any

emergency. Check us out at:

www.sunsaver.co.nz

Building versatile and reliable gear so you

can adventure with purpose.

www.keaoutdoors.com

Temerature. Taste. Transport.

Hydroflask, more than just a water bottle.

www.hydroflask.co.nz

Our mission is to produce

the best quality beers

possible across a range of

flavours and styles and to

have fun doing it!

www.dcbrewing.co.nz

Gear up in a wide selection of durable, multifunctional

outdoor clothing & gear. Free Returns. Free Shipping.

www.patagonia.co.nz

Stocking an extensive range

of global outdoor adventure

brands for your next big

adventure. See them for travel,

tramping, trekking, alpine and

lifestyle clothing and gear.

www.outfittersstore.nz

Specialists in the sale of Outdoor Camping Equipment, RV,

Tramping & Travel Gear. Camping Tents, Adventure Tents,

Packs, Sleeping Bags and more.

www.equipoutdoors.co.nz

Our very own online store where

you will find hard goods to keep you

equipped for any adventure.

www.pacificmedia-shop.co.nz

www.lightandfast.co.nz

Zerofit is a range of base layers

and lifestyle clothing straight

out of science fiction.

Using your body movement, it

keeps you warm and improves

your performance.

www.zerofit.com.au

Meals bursting with flavour, combined with home compostable

packaging, means you really can have it all in the mountains.

Designed by ‘foodies’ for maximum plant-based deliciousness

and wrapped in earth positive, lightweight, packable pouches.

www.localdehy.co.nz

Bivouac Outdoor stock the latest in quality outdoor

clothing, footwear and equipment from the best

brands across New Zealand & the globe.

www.bivouac.co.nz

Shop for the widest range of Merrell footwear, apparel

& accessories across hiking, trail running, sandals &

casual styles. Free shipping for a limited time.

www.merrell.co.nz

Norsk designs and builds ice coolers that without fail,

will not fail. Perfect for your hard out adventures.

Free shipping within New Zealand.

www.norsk.co.nz

Living Simply is an outdoor clothing and equipment

specialty store in Newmarket, Auckland. Your go-to place

for quality footwear, packs, sleeping bags, tents,

outdoor clothing and more.

www.livingsimply.co.nz

www.glerups.co.nz

glerups shoes, slippers

and boots are known for

their exceptional comfort

and unique design.

Over the years we have

perfected the wool mix

by blending Gotland

wool with quality wool

from New Zealand

farmers.

Fast nourishing freeze dried food for adventurers.

www.backcountrycuisine.co.nz

Sustainably designed outdoor gear that fuels both

adventure and global change, by dedicating a

percentage of revenues to nonprofits working to improve

the human condition. www.cotopaxi.com

Supplying tents and

camping gear to Kiwis

for over 30 years, Kiwi

Camping are proud to

be recognised as one of

the most trusted outdoor

brands in New Zealand.

www.kiwicamping.co.nz

With stores in Clyde and

Cromwell, Bike it Now! is

your access point to the

Central Otago Bike trials: T

> Lake Dunstan Trail

> Otago Central Rail Trail

> Roxbourgh Gorge

and more...

New Zealand’s first online

store solely dedicated to

Non Alcoholic adult drinks.

www.clearheaddrinks.co.nz

www.bikeitnow.co.nz

Serving Hot Mexican & Cool Margaritas since 1995

Locations in Alexandra, Cromwell, Dunedin, Invercargill, and Wanaka

See the latest menu and BOOK ONLINE at

www.amigos.co.nz

@amigos_nz

t r a v e l

CLIMBING MT SILISILI

Words and images by Ross Bidmead

The climb began with an ava (kava)

ceremony with the matai (chief). We

were welcomed into his fale (house)and

invited to sit cross-legged on the floor. A

cup made from half a coconut shell was

dipped several times into the ava pot

and poured back to test the colour and

consistency of the ava. Once he was

satisfied with its look, the cup was formally

offered to me, and I raised the cup with

two hands, said "manuia" and drained it.

The bitter liquid numbed my tongue, but

it otherwise had little effect. Margaret and

Tino, in turn, drank a toast from the same

cup before the ceremony continued with

the guide and porters, who drank several

cups as if hydrating for the hot walk

ahead.

Mt Silisili, at the height of 1,858m, is the

highest point in this part of the Pacific;

located on Savai'i, the larger but less

populated of the two main islands

of Samoa, it had always seemed a

fascinating place to explore.

Margaret, who was a friend and client

from a cycle tour, asked if I could organise

a trip; the opportunity was too good to

pass up. Never mind that there was

no route map, and I had heard rumours

of a lack of water, hidden trials and the

need for a guide. Planning and research

are half the fun of any trip; we knew the

starting point and had a phone number for

a local guide.

I called the guide, "Yea, no problem; we

provide sleeping bags, tents, and cooking

equipment. Just bring your own food." It

sounded easy, and we arranged a place

and time to meet. Like with all adventures,

what could go wrong?

Villages own most land in Samoa under

the customary title, and it is usual to

have to pay an access fee. It is, without a

doubt, far better to pay the small access

fee and employ local labour than have

the village need to earn revenue from the

native forest by milling it.

We live in Samoa half the year, running

bike and kayak tours, while Margaret

worked in Apia as an epidemiologist

studying Filariasis (elephantiasis, a

tropical disease carried by mosquitos).

Tino, our leading kayak guide, joined the

group both as an interpreter and to learn

the route.

The recognised route up Mt Silisili starts

at Aopo village. The mountain's highest

settlement, yet it is still only 200m above

sea level. Aopo was on our cycle route

around Savai'i and a regular stopping

point as it was at the top of the steepest

hill of the ride. It was one of the few

villages unable to rely on protein from

fishing and always seemed poorer than

most. The shop seldom stocked soft

drinks but, when asked, would offer beer

instead!

Our instructions were to stop at the church

when we arrived, and the guide would

meet us. There was no one there, so I

phoned the guide. "I live in Apia – I only

organise the trips, but you're expected."

Eventually, the confusion was sorted, and

we were directed to a fale on a dirt road

where we were welcomed by our guide

Talu and porters David and John.

With the ava ceremony complete, Talu

produced tents and sleeping bags for the

trip. Living on the coast in Samoa, I was

used to sleeping under just a sheet, but

we could expect temperatures around

12°C at the campsite. I'd also had to find

a raincoat and jersey, items I didn't usually

need. It can rain in Samoa, but a jacket

with the best Gore-Tex fabrics usually

means getting wet from the inside while

overheating.

I'd expected to leave the car in the village

and start from there, and retrospectively

we should have! But the guide convinced

us that the road was passable and would

save a couple of hours. . With the six of

us and all our gear in our our small AD

Van station wagon, it nearly rested on the

bottom of its suspension and we picked

our way slowly up the steep, overgrown

road. I misjudged and grounded the car

hard on a rock hidden in the grass. With

everyone out and pushing, we cleared it,

but there was a new vibration somewhere.

The van was not an offroad vehicle.

Wishing I had bought the Pajero, we

ground on slowly past taro plantations and

regenerating forest until we reached a

grassy clearing by a stream.

From here, a ground trail led into the

forest. We were soon surrounded by

giant dark trunks up which monsteras

climbed, their vast, holey leaves providing

a green contrast. Everything was wet,

and epiphytes were everywhere. Much of

Samoa must have been covered in this

tropical rainforest, but this was the first

remnant of the original that I had seen.

We climbed on, slowly traversing to the

right as the trees got smaller. There were

almost no track markers, and the route

was not marked on any map.

Without a local guide, it would have been

challenging. At a flat spot on a ridge, there

were obvious signs of a regular camp spot

and a kettle hanging in a tree. The guides

grabbed it as their only cooking pot, and I

was glad I had put in a billy.

Later we emerged from the forest onto

lava fields from the 1902 eruption of Mt

Mata o le Afi. Twisting an ankle here

would be easy, and there is no helicopter

or organised mountain rescue service in

Samoa.

From here, the route opened to the crater

of Mata o le Afi; a deep hole surrounded

by acres of coarse dark sand devoid of

vegetation. A local company had wanted

to quarry the sand and had built an access

route to here (via a different path than the

track we used). Fortunately, the nearby

villages vetoed the plan as they did not

wish to awaken the volcano.

Where the first vestiges of vegetation

reappeared, there were the remains of a

campsite. The two small water tanks with

catchments barely more than a length of

guttering were full, and our water worries

were over. We had arrived here much

earlier than expected, and the weather

gods were smiling on us, granting a

sunny, cloud-free day, a rarity up here.

We continued to the top, following a small

trail meandering around a wetland with

several deep ponds. A short climb through

a spindly forest brought us to the top after

little more than an hour. As there was only

a narrow view inland through the spindly

clouded forest, we headed back to the

campsite after a quick round of photos.

We pitched our tents while the guides

prepared a fire and boiled the kettle found


at the lower camp. But to our surprise,

they made a large pot of tea sweetened

with condensed milk and sugar to the

point where we couldn't drink it. They

then kept the remainder in the pot for their

evening use. So much for "the guides

will bring the cooking gear." It wasn't

like the guiding service we were used to

from Nepal. This was just a difference

in expectations. They were friendly

and helpful but expected us to be selfsufficient

in food and cooking.

The weather was turning on a charm

offensive. When we eventually wandered

over to the crater rim, the stunning views

Always handy to find a spare kettle hanging in a tree

of the coast and the Falealupo Peninsula

at sunset were a good reward for our

additional effort.

Tramping meals are usually a trip

highlight, but with our limited access to

supplies in Samoa and even more limited

access to cooking resources at the camp,

the meal became a slow refuelling stop.

Fortunately, Margaret had lived here long

enough to be unfazed, and the challenge

only added to the adventure.

Walking down was uneventful, but as

we started down the road in the car,

the vibrations got steadily worse. After

dropping off and thanking our guides,

we limped on. The car was in danger of

rattling to death above 30kms/hr, forcing

us to stop in a village and borrow a

hammer. Tino and I took turns to crawl

under the car and bash the recalcitrant

bearing nearer the right place. We gained

some speed but couldn't reach the Samoa

open road limit of 56 km/hr!

The day finished at the Beach Fales at

Manase where we swam and then relaxed

on the beach with a glass of wine and the

setting sun. Adventures are always better

with a few challenges.

Contact Ross and Frances at: [email protected] to organise a custom tour or to join a group.www.outdoorsamoa.com

Sunset towards the Falealupo Peninsula

A great way to end the day

The original vegetation of Samoa and a

clear view to the top of Mt Silisili

Ross, Tino and the guide team - Note the

special jandals for rough and muddy terrain


Beautiful Samoa awaits you, and we are welcoming our international aiga

with open arms! Experience Samoa’s untouched beauty, unique cultural

experiences and rich heritage. Self drive, bike or stroll through the wonders

that make this island life one to cherish just like the locals do.

Cook Islands.

Lonely Planet’s top place to visit in 2022

Float above the world’s bluest blue

OVERWATER HEAVEN

Images by Steve Dickinson

Surround yourself in an

ocean of beauty while diving

in The Islands of Tahiti. Here

you’ll dive in the presence

of deep-sea giants such

as sharks, rays, turtles and

dolphins.

Our waters are teeming with

life where each dive brings a

new treasure to uncover and

a new story for you to share.

DIVING.TAHITITOURISME.COM

t r a v e l

The stunning backdrop that is Teahupo'o

TEAHUPO'O

MAGESTIC, STUNNING AND TERRYFYING

Words by Steve Dickinson | Images compliments of WSL/ Damien Poullenot

Covid is bad enough, but to see the those two ugly

little lines on your RAT test the day before you are

meant to leave for Tahiti is so frustrating. Weeks of

planning had gone into the coordination of getting us

to Tahiti and to the WSL (World Surf League) event

at the legendary location, Teahupo'o. To make it

worse this year was really special because it was the

first time that female competitors have returned to

compete at Teahupo'o after a 16 year hiatus.

Teahupo'o means ‘The pile of heads’ or ‘The heap of

heads’. It supposedly honours the son of a murdered

chief, who revenged his father's demise by killing

and eating the brain of his father's murderers. It is a

dark name for such a magical place. On the island of

Tahiti Iti, which is linked to the main island of Tahiti by

a slim causeway, you’ll find Teahupo'o. Commonly

known as the end of the road, and it is literally the

end of the road, Teahupo'o is a rural jungle-like

setting with a backdrop of lush green-coloured

mountains. A river flows out from the mountains

through the lagoon and has caused a unique coral

formation, which not only gives some of the best

waves in the world it also creates an amphitheater

for spectators in boats to be close to the breaking

waves.

Unlike soccer or rugby, surfing is a sport basically

done in isolation or with just a few others. There

maybe be crowds on the beach, but not just meters

away, right there on the sideline. But at Teahupo'o, it

is different. Waves can be massive, and you can still

be within a relatively short distance and still be safe

(well, fairly safe).

Teahupo'o is all about the barrel, the breaking wave

that tubes. In many parts of the reef, there is only

50cms of water between the reef and the water

surface, which creates amazing waves but falling off

can be unpleasant.

In simple terms, this magical thick heavy wave

is created by a dramatic change in water depth.

Approximately 50 metres out to sea from the shallow

reef, the sea drops to more than (15 metres). This

means swells coming towards the reef transform

from deep water swells to shallow reef waves in a

markedly short distance. This then causes the wave

to rise up suddenly over the reef before pounding

down with extreme force and then dissipating into

the lagoon.

Teahupo'o is renowned as a thick-lipped wave which

can at times be incredibly hollow. Thick heavy waves

breaking over shallow reef, barrelling, makes for

an amazing visual spectacle, but the surfers need

not only to cope with the wave but the fear the

consequence should they fall onto that shallow reef.


So, with Teahupo'o, not only have you a

magical Pacific setting with clear water and

some of the best waves in the world, you can

also be within meters of the activity. Then add

in the best surfers in the world, and it is an

event we have long been waiting for.

Then came covid.

But we did get to watch the event on

television from the comfort of our couch in

front of a roaring fire. Not quite the real deal

but pretty good none the less. We could not

shoot our own images this year, but thanks to

the WSL for providing them, and as you can

see, it was stunning.

The event is run over a two-week period

where WSL choose the best three days to

run the event. There was an infuriating week

of lay days as the swell just failed to turn up,

but on the Thursday of the second week, the

waves turned on at 5-8 ft. The event was so

exciting, and we could go through each heat

blow by blow.

But the highlights were 50-year-old Kelly

Slater’s flawless run to the semifinals. Nathan

Hedge, who was the 40-year-old wildcard

surfing like a 20-year-old and the humble

Matthew McGillivrays perfect 10 (the best

score you can get in surfing). Spectators

sitting at home and in the flotilla of boats

close to the waves were rewarded for their

weeklong patience with everything you could

want from a season-ending event.

But the biggest story of this event was Kauli

Vaast, the local boy who has won his spot

through the trails, who lives at Teahupo'o

and stormed his way to the finals with the

most dominant performances of the event.

At only 20 years old, he showed his class

when he came up against the 50-year-old

GOAT Kelly Slater, 11 times world champion,

in the semifinals and beat Slater 17.33 to

1.17. Kauli’s charge to the winning post was

stopped by an in-form Miguel Pupo, who

found a 9-point ride in the final to narrowly

beat out the local 17.17 to 15.00.

Two of the event highlights:

Above: Kelly Slater

Right: Nathan Hedge



Top: Courtney Conlogue took out the Outerknown Tahiti Pro at Teahupoo

Inserts: Kauli Vaast's support crew cheered loudly | Miguel Pupo overcome with emotion after taking the win at Teahupo'o

Bottom right: Kauli Vaast showed how important wave knowledge was at his local break, Teahupo'o

16 years ago, we were there to witness the last time the

women competed at Teahupo'o. Not a lot had changed. The

waves were still mean, and if you got it wrong, there are

profound consequences, so naturally, nerves were on edge.

From the first heat, the woman to beat seemed to be Vahine

Fierro, the local girl who understood Teahupo'o well. But

Vahine was eventually stopped in the semifinals by one of the

regular CT competitors Brisa Hennessey.

The other in-form surfer was Courtney Conlogue, who is

renowned for her athleticism, fitness, and grit. Courtney,

out of all the women, seems to be able to tame the wild and

dangerous beast that is Teahupoo. She convincingly won the

women’s event and proved that women could surf Teahupo'o

just as well as men.

As a side note, with the Olympics looming in 2024, Tahiti is

set to host the surfing for the Paris Olympics, and Teahupo'o

will be where that portion of the competition will be held. This

will be a challenging event for everyone involved but, again,

another huge spectacle.

Surfing is part of the lifestyle in Tahiti; waves are on nearly

every island and surf, (unlike Teahupoo), which can suit

everyone. Teahupo'o to surfers is like Everest is to climbers;

it is the pinnacle of the sport, but not many get to climb or

even want to climb Everest, but there are still lots of other

hills and mountains to climb. Same with surfing in Tahiti,

if Teahupo'o is beyond your skill level (as it is with most

people), then there are a lot of other options, reef breaks,

beach breaks, some remote, some close to town, but the

common denominator is the water is warm and clear, the

people friendly and the waves are always great!


*

t r a v e l

VANUATU

8 LIFE-CHANGING

HIKING EXPERIENCES

As you might expect from a jungle-covered archipelago, Vanuatu

has some of the best tropical trekking in the world. Where else

can you hike to the rim of an active volcano, sleep in kastom

villages or cool off under roaring waterfalls? From half-day hikes

on the main islands to multi-day jungle treks on the outer rim,

there’s some truly epic scenery to explore in Vanuatu.

1. Nguna Extinct Volcano (pictured: Image by Ben Savage)

(3 hours from the bottom of Nguna)

An hour away from Port Vila’s bustling city centre and resorts

lies Nguna and its sister islands, Pele and Emao. Located in the

crystalline water of the Uduna marine channel, the islands are

home to 16 local communities that have created the Nguna-Pele

Marine Protected Area. This pristine environment of lagoons,

reefs, mangrove forests and bush gardens is the perfect

landscape for following your guide to the top of Mt Taputoara, the

highest of the two extinct volcanoes on Nguna Island. The trek

takes you through several welcoming villages and is a steady

uphill climb to the edge of the crater at 593 metres above sea

level. Some parts of the track are steep, but it is well worth the

effort, as you will be rewarded by sweeping views across the

Shepherd Islands to the north and south to Efate.

2.Dog’s Head Trek, Malekula

(2-day trek departing Norsup)

Malekula is shaped like a sitting dog, and the northern part of

the island, the ‘Dog’s Head’ is crisscrossed with some of the best

hiking trails in Vanuatu. A popular route is known as the Dog’s

Head Trek. It’s a two-day hike from Malekula’s east coast, all

the way over the rugged hinterland mountains, to the charming

western village of Tenmaru. Along the way you’ll meet the Small

Nambas and Big Nambas (two of the island’s major tribes), get

a crash course in Malekula’s history of cannibalism and swim in

cascading river pools, hidden deep within the forest.

3. Mount Garet Hike, Gaua

(3-day trek, starting Gaua Airport) Rising from the sea in the

north of Vanuatu’s archipelago, Gaua is the country’s unofficial

adventure capital. Mount Garet is the island’s highest peak, an

active somma volcano (it last erupted in 2011) surrounded by

a horseshoe caldera, the beautiful Lake Letas. Travellers can

embark on a three-day hike to explore Mount Garet. You’ll climb

to 711 metres above sea level, see bubbling lava and volcanic

mud pools and swim beneath the stunning 120-metre high Santa

Maria waterfall. At night, you can sit around the campfire on the

shores of Lake Letas and swap stories with your local guides.



4. Benbow Crater Hike, Ambrym

(Pictured above: Image by Ben Savage)

(2-4 day hike)

The island of Ambrym has always been

one of the more mysterious in Vanuatu’s

archipelago. It’s known as the Black

Island, due to its volcanic soil and history

of dark magic. But it’s also home to two

of Vanuatu’s most active volcanoes –

Mount Marum and Mount Benbow. There

are dozens of hiking options through the

surrounding jungle. If you’re feeling fit,

you can try the one-day hike to Benbow’s

crater rim (a 10-hour round trip), or you

can sign up for two, three or four-day

treks that allow you to explore the whole

volcano field. If you’re planning a trekking

holiday on Ambrym, travelling between

August and January is generally best.

7.Losinwei Cascades Walk, Malekula

Not all 6 Vanuatu’s treks require a fullystocked

backpack and several days

up your sleeve. Malekula’s Losinwei

Cascades Walk is the perfect example.

It’s a half-day hike into the misty foothills

of central Malekula. Guides will lead

you through the forest, surrounded by

tiny orchids and flowering irises, to the

picturesque Losinwei Waterfall. You can

swim beneath the falls, climb the rock

face to find hidden limestone pools,

and generally laze the day away before

trekking back down to Losinwei Beach.

5. Trek Tanna, Tanna

(4 hours, starts Mount Yasur ash plains)

In 1774, the sparks of Mt Yasur volcano

attracted Captain James Cook during

his journey through the South Pacific. It

has since been called ‘the Lighthouse

of the Pacific’. Take a once-in-a-lifetime

adventure that follows in the footsteps of

the famous world explorer and barefoot

warriors to the top of exhilarating Mt Yasur

volcano. Start your expedition on the ash

plain and enjoy the breathtaking views;

meet the John Frum cult village; and feel

the power of the volcano as you climb its

slope. As the sun sets after an afternoon

of bushwalking, you will stand close to

the edge of the crater, 361 metres above

sea level, and be rewarded by the most

fascinating and thrilling natural fireworks

and panoramic views.

6. Manbush Trail, Malekula

(4-day hike)

The Manbush trail is an unforgettable

four-day hike from east to west across the

wild highland rainforest of Malekula. The

trek takes you to the stunning South West

Bay and its pristine black and white sand

beaches, passing through the summit of

Mt Laimbele, 850m above sea level with

360-degree views of the archipelago.

Along the way, you will encounter dense,

untapped jungle, traverse incredible

rivers, snack on island bush foods and

climb to an incredible 850 metres above

sea level. At the end of the trek, there’s

still time to cool off in the clear waters

of the Matanoi River. Accompanied by

not-so-ancient tales of cannibalism,

you’ll follow your local guide into the dark

bush and make yourself at home in selfsufficient

remote villages – where you will

sleep in local houses and learn all about

traditional kastom living. The Manbush

trail crosses rivers, passes through deep

bush and climbs steep ground. It is a

challenging expedition for experienced

bushwalkers, taking you on a journey to

a part of the world rarely seen by most

people.

8. Millennium Cave, Espiritu Santo

Millennium Cave is one of Santo’s most

famous natural attractions. It’s also the

largest cave in Vanuatu. The trek to reach

the cave isn’t the longest walk in the world

(it takes around 90 minutes from Vunaspef

village) but the route is challenging. You’ll

be scrambling up slopes, fording streams

and climbing giant river boulders. But it’s

well worth the effort as Millennium Cave

is truly stunning. You’ll explore the cave in

the dark, using nothing but a torch, learn

about local food and kastom, and cool off

in the rock pools outside the cave. It’s one

amazing – if exhausting – Santo day tour.

For More Information: www.vanuatu.travel/nz/experiences/hiking-guide

For Specialised Services contact: vanuatuecotours.com and wreckstorainforest.com


9.30am Mt Yasur on Tanna Island

Hiking Diving Culture

Volcanos

Go explore at vanuatu.travel

There’s always something happening at Surreal

3 Levels with the best Rooftop Terrace in town.

House Made Mulled Wine, Mulled Cider and $15 Cocktails sets you up for Apres Ski.

Delicious and affordable crowd pleasing food favourites.

Team that up with an exceptional Bar Menu with the happiest team in town and you’re set!

The heated ROOFTOP TERRACE is always the place to be any night of the week.

Fridays, Saturdays and Sundays we step it up a notch with the hottest DJs in town.

Downstairs offers all your sporting action with entertainment every night of the week.

Check out our website for all the latest info on Events, Specials and Gig Guide.

Surreal Bar and Restaurant - Open from 12 until late.

7 Rees Street, Queenstown

Phone: 03 441 8492 www.surrealbar.co.nz

A l p i n e R e s o r t

Terrace Restaurant & Bar Open daily

5 minutes from Whakapapa Ski field

Backpacker to Superior Family Accommodation

On-Site Ski & Snowboard gear hire

Skotel Alpine Resort | SkotelAlpineResort

Ngauruhoe Place | Whakapapa Village, SH 48

www.skotel.co.nz | [email protected]

+64 7 892 3719 | 0800 756 835

Dual Heritage

Tongariro National Park

Sky Waka Hot Deal

2 Nights in a King Studio | Breakfast Daily | 2 x Sightseeing Pass Sky Waka

2 x Mini Golf pass | $50 Food & Beverage Voucher

BYO Bikes & explore our 4 biking trails from National Park Village

Free wifi & parking | From NZD $599

17 Carroll Street, National Park 3948

[email protected] | +64 7 8922993

www.plateaulodge.co.nz

The Old Nurses hOme

GuesThOuse

Welcome to The Old Nurses Home Guesthouse

This historic renovated building in Reefton allows you to enjoy the stunning

Victoria Conservation Park with access to outstanding bush walks, historic

mining sites, and withing walking distance to the famous Inangahua River and

some of the best fishing for trout in NZ. White water raft or kayak the exciting

rivers in the area. Reefton offers a perfect base for MTB riders to explore The

Old Ghost Road from Lyell through the ranges to Seddonville on the West Coast.

www.reeftonaccommodation.co.nz

+6437328881

[email protected]

get the

professional

edge!

The V-SHARP® CLASSIC II Elite uses two high-quality, 325

grit diamond rods that simultaneously sharpen the blade

on both sides using calibrated Spring Tension. Ideal for

Kitchen, Fillet, Hunting and most other flat-blade knives.

w w w . k n i f e s h a r p n e r s . n z

Boots

Packs

Rainwear

Sleeping Bags

All your tramping & trail essentials!

Same shop & family since 1988.

Keep powered on any adventure

www.sunsaver.co.nz

Reeecoveeer

Fasteeer

OOOOOOOOOOOOFFOOOOOOSS

ffffffffoooooooooooooooottttttttwwweeeeeeeeaaaaaaaarrrrrrrr

ccccuuuusssssssshhhhhhhiiiiiiiioooooooonnnnnnnnssssssss && ssssssssuuuuppppppppppppoooooooorrrrrrrrttttttttssssssss

yyyoooooooouuuurrrrrrrr ffffffffeeeeeeeeeeeeeeeetttttttt,,, aaaaaaaannnnnnnnkklleeeeeeeessssssss,,, kknnnnnnnneeeeeeeeeeeeeeeessssssss

&& hhhhhhhiiiiiiiippppppssssssss bbbyyy aaaaaaaabbbssssssssoooooooorrrrrrrrbbbiiiiiiiinnnnnnnng 37%

mmmoooooooorrrrrrrreeeeeeee iiiiiiiimmmppppppaaaaaaaacccctttttttt tttttttthhhhhhhaaaaaaaannnnnnnn ooooooootttttttthhhhhhheeeeeeeerrrrrrrr

ffffffffoooooooooooooooottttttttwwweeeeeeeeaaaaaaaarrrrrrrr ffffffffooooooooaaaaaaaammmssssssss.. Afffffffftttttttteeeeeeeerrrrrrrr

aaaaaaaannnnnnnnyyy aaaaaaaaddveeeeeeeennnnnnnnttttttttuuuurrrrrrrreeeeeeee,,, ffffffffeeeeeeeeeeeeeeeell tttttttthhhhhhheeeeeeee

ddiiiiiiiiffffffffffffffffeeeeeeeerrrrrrrreeeeeeeennnnnnnncccceeeeeeee wwwiiiiiiiitttttttthhhhhhh eeeeeeeeaaaaaaaacccchhhhhhh

sssssssstttttttteeeeeeeepppppp iiiiiiiinnnnnnnn aaaaaaaa ppppppaaaaaaaaiiiiiiiirrrrrrrr ooooooooffffffff OOOOOOOOOOOOFFOOOOOOSS..

Feed your adventure!

Vegan

Sustainable

Made in Wānaka

Order online: www.localdehy.co.nz

LOCAL DEHY

FOOD FOR THE HILLS HILLS

glerups.co.nz

Find us online and at a stockist near you

“Escape ordinary”

Caring luxury | Local flavour | One of a kind

Mountain bike clean up area and a secure mountain bike storage area available

1191 Pukaki Street, Rotorua

p: +64 7 348 4079 | w: regentrotorua.co.nz

S.A Shuttles are a specialists when it comes to Auckland Airport shuttle

services. We pick-up passengers from the Airport and deliver to; hotels,

motels, CBD and the suburbs (door to door). This service is available to

meet every flight arriving into Auckland Airport.

• BOOKED shuttle services to meet flight

• On demand shuttle services for group bookings

• Direct shuttle for individual needs

• Corporate Transfers for Business Client

We also do tours around the North Island | www.southaucklandshuttles.com | [email protected] | 0800 300 033 (Toll free)

A digital currency

designed for everyday

payments

qoin.world

Available to download on

THE ALL-NEW 7-SEAT

Adventure 234

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?